Journal of Microbiology and Biotechnology - Manuscript Submission ...

collectiveyazooΒιοτεχνολογία

12 Φεβ 2013 (πριν από 4 χρόνια και 5 μήνες)

335 εμφανίσεις

FOR REVIEW

Journal of Microbiology and Biotechnology
-

Manuscript Submission

Manuscript Draft

Manuscript Number: JMB11
-
09061

Title: Production, purification and characterization of antifungal metabolite
from Pseudomonas aeruginosa SD12, a new strain obtained from tannery
waste polluted soil

Article Type: Research article

Keywords: Antimicrobial activity, Pseudomonas aeruginosa,
1
-
hydroxyphenazine, Siderophore, 16S rRNA

FOR REVIEW
Dear Editor,

Thanks for accepting our manuscript for publication with minor changes. We hace made Corrections in the
revised manuscript in the light of comments by the reviewer as follows:

1. in abstract (line 10) R. solani is corrected as Rhizoctonia sola
ni

2. Pseudomads corrected as Pseudomonas (page 2, line 18, page 3 line 3) and other places also

3. word communication is replaced by paper (page 3 line 23, page 4 line 6)

4. space in between 4 and
0
C,

25 and
0
C, 28
0
C, 6
0
C, 50
0
C is created (page 4 line
19, page 8 line 5
-
6, 15,
16, 18) and other places also

5. SD
-
12 was corrected as SD12 (page 7 line 13, page 12 lines 8, 11, 20) and other places also

6. Table
-
2 corrected as Table2 (page 12 lines 5, 17, 22, page 15 line 17) and also at other places

7. In r
efrences we have removed several mistakes (typographical, journal abbreviation and formatting
according to the prescribed style)

8. We have also corrected the manuscript removing grammetical mistakes in the sentences and title of the
paper.

We aer submitti
ng the revised version of manuscript including figures and tables and

hope now manusripts
is acceptable for publican in the Journal of Microbiology and Biotechnology. You are requested to kindly
process for an early publication.

Thanking you with kind rega
rds.

Mansoor Alam




FOR REVIEW
1


Production, purification and characterization of antifungal metabolite
1

from
Pseudomonas aeruginosa

SD12
,
a new strain

obtained
from

2

tannery waste polluted soil

3


4

Seema Dharni
1
, Mansoor Alam
*
2
,

Komal Kalani
3
,

Abdul
-
Khaliq
2
, Abdul Samad
2
,

5

Santosh Kumar Srivas
tava
3
, Dhar
a
ni Dhar Patra
1

6


7

1
Division of Agronomy and Soil Science,
2
Department of Plant Pathology,

3
Department
8

of Analytical Chemistry, Central
I
nstitute of Medicinal and Aromatic
P
lants,


9

P.O. CIMAP, Lucknow 226015, India

10


11

*
Corresponding author,
Email:
e
mail2alam
@rediffmail.com

12

Phone:

+91
-

522
-

2718531

13

FAX: +91


522
-

2342666

14


15

Running title:

New strain of
Pseudomonas
aeruginosa

from
polluted soil

16

17

FOR REVIEW
2


Abstract

1


A new

strain SD12
was
isolated
from the tannery waste

polluted

soil and
2

identified as
Pseudomo
nas aeruginosa

on the basis of phenotypic traits and by
3

comparison of
16S rRNA

sequence. This bacterium exhibited broad spectrum
4

antagonistic

activity
against

phytopathogenic fungi.
The strain produced phosphatases,
5

cellulases, proteases, pectinases
and HC
N and

also
retained its ability to

produce
6

hydroxamate
type siderophore
.

A bioactive metabolite was isolated from
P. aeruginosa
7

SD12 and
was
characterized as 1
-
hydroxyphenazine
(
(
1
-
OH
-
PHZ
)

by nuclear magnetic
8

resonance
(
NMR
)

spectral analysis.

The strain w
as used as biocontrol

agent against root
9

rot
and
wilt

disease of pyrethrum caused by
R
hizoctonia

solani
.
The stain is also
10

reported to increase the growth and biomass of
Plantago ovata
.
The
purified compound
,

11

1
-
hydroxyphenazine
also
showed a broad
-
spectr
um
antagonistic

activit
y
towards a
12

range of
phytopathogenic

fungi

which is the first report of its kind
.


13

Key Words:

Antimicrobial activity,
Pseudomonas
aeruginosa,
1
-
hydroxy
p
henazine,
14

Siderophore
, 16S

r
R
NA

15


16

Introduction


17



The fluorescent
p
seudomona
s

inc
ludes

P. aeruginosa,

P. auerofaciens
,
P.

18

fluorescens, P. putida
,
P. pyrrocinia

and

P
.
syringae

which

produce fluorescent
19

pyoverdine siderophore
(
s
)

[
8
]
.

These are
easily distinguishable from other bacteria
20

owing to their ability to produce water
-
soluble,

ye
llow green
pigments
[
3
8
]
.

The
p
lant
21

growth promoting ability of

the

fluorescent
p
seudomonas

is mainly because of the
22

product
ion of indole
-
3
-
acetic acid,
siderophores and

antibiotics
(
pyrrolnitrin, 2, 4
-
23

FOR REVIEW
3


diacetylphloroglucinol
(
2, 4
-
DAPG
)
,
pyoleuteorin and p
henazine
)

which have

broad
1

spectrum antimicrobial activities
[
25
,

18
, 3
2
]
.

Genes encoding the production of these
2

antibiotics in
a
fluorescent
p
seudomona
s

have been identified, cloned and characterized
3

[
26
]
.

4




Pseudomonas aeruginosa
is one of the most co
mmon soil inhabitants
and it

play
s

5

an important role

in
plant growth and suppression of soil born plant pathogens. It
6

survives in soil and colonizes
on
root surfaces and serve
s

as

a

biological control agent.

P
.

7

aeruginosa

produce
s

the
blue
-
green pigment py
ocyanin
(
5
-
N
-
methyl
-
1
-
8

hydroxyphenazine
)

and

several others phenazines including
aeruginosine A
and

B,
9

phenazine
-
1
-
carboxylic acid
(
PCA
)
,
1
-
hydroxyphenazine

and

phenazine
-
1
-
carboxamide
10

(
PCN
)

[
19
]
.

The

phenazines produced by
P.

fluorescence, P.

chlororaphis
and
P.

11

aeruginosa

inhibit
fungal phytopathogens including

Gaeumannomyces graminis
var
.

12

tritici
,
Fusarium oxysporum
,
Pythium

spp.,
Rhizoctonia solani
,
Gibberella avena
c
ea,

13

Alternaria

spp. and
Dre
c
hslera graminea
[
15, 11
]
. Most phenazines produced by
14

Pseudom
onas

spp. are simple carboxy and hydroxyl substituted derivatives, and
15

consequently their antibiotic
activity differs

according to the nature and positions of
16

substitutents on the heterocyclic
ring. The
metabolite
s
,

2
-
hydroxyphenazine
-
1
-
17

carboxylic acid, 1
-
hydroxyphenazine and phenazine
-
1
-
hydroxamide
(
PCN
)

from
P.

18

aeruginosa

have the greatest antifungal activity
in vitro
.
Phenazines increased survival
19

in soil environments and were

essential for the biological control activity of certain
20

Pseudomonas

strains

[
2
8
]
.

P.

aeruginosa

produced siderophores on chrome
-
azurol
21

sulphonate
(
CAS
)

agar
and
also

hydrocyan
ic acid

(
HCN
)

and

indole acetic acid
(
IAA
)
.

22



In this
paper

we
re
ported the isolation of

a

new strain of
Pseudomonas

from
the
23

tannery waste polluted soil

which was

identified

as
P. aeruginosa
strain SD12

on the
24

FOR REVIEW
4


basis of phenotypic characters and

16s rRNA sequence analysis. We also described
1

production of siderophore,
ex
tracellular hydrolytic enzymes, phosphatase and
a
2

metabolite

by this strain. The biocontrol
as well as growth promotion

activit
y
of this
3

strain
were

also demonstrated. Characterization of antifungal compound from this strain
4

and its
in vitro

application ag
ainst a wide range of plant pathogenic fungi are also
5

reported in this
paper
.

6

M
aterials and Methods

7

Isolation and screening of fluorescent
P
seudomonas


8

S
oil samples were collected from the tannery waste polluted area of Jajmau, Kanpur in
9

Uttar Pradesh, Ind
ia during October 2009
and
were

dried at ambient temperature.
10

Isolations were carried out on Pseudomonas Isolation Agar
(
PIA
)

following serial
11

dilution technique of Hammond and Lambert

[
17
]
.
Colonies were further purified by
12

streaking onto King’s B agar me
dium

[
23
]

and screened for fluorescence under UV light
13

(
366 nm
)
.

14

Phenotypic characterization of P. aeruginosa SD12

15


Bacterial isolates were characterized for phenotypic and biochemical traits
16

according to Bergey’s Manual of Determinative Bacteriology
[
7
]
.

Catalase, levan
17

formation, ni
trate reduction, starch, casein
,

gelatin liquefaction
, glycine, arginine
18

dihydrolase, phenyl acetate

and growth at
pH
5
-
7 and 4

o
C


42

o
C were recorded
19

following the methods described by Bossis
et al.

[
8
]


20



Carbon utilizatio
n profiles were tested using Hicarbohydrate
TM

kit as described
21

by the manufacturer
(
Himedia Laboratories, Mumbai, India
)
. The data derived from the
22

FOR REVIEW
5


carbon source utilization profile was later confirmed by Institute of Microbial
1

Technology
(
IMTECH
)
,

Chandig
arh, India.

2

16S rRNA gene amplification, sequencing and phylogenetic analysis

3


Total

genomic DNA was extracted by method described by
Naik

et al.

[
2
9
]
. The
4

16S rRNA
sequence

was selectively amplified by PCR using universal primers fD1
(
5’
-
5

GAGTTTGATCCTGGCTC
A
-
3’
)

and rP2
(
5’
-
CGGCTACCTTGTTACGACTT
-
3’
)

(
36
)
.
6

Amplification was carried out in automated thermocycler
(
Eppendo
r
f
)

according to the
7

following amplification profile
:

initial incubation
(
94

o
C for 4 minutes
)

followed by
8

denaturation
(
30 cycles of 30s at 94

o
C
)
, annealing
(
30s at 59

o
C
)

and elongation
9

(
1.30min, 72

o
C
)
. The reaction was terminated with a final extension at 72

o
C for 5
10

minutes. Aliquot
s of

8µl of amplifi
ed

product
were

electrophoresed on a 1.2% agarose
11

gel in 1x Tae buffer at 50 V for 60 min,
stained with ethidium bromide, and the PCR
12

product was visualized
on

a
UV trans
-
illuminator. The amplicon generated by PCR was
13

cloned
i
nto pCR
®
-
TOP
O

TA
®

cloning vector V2.0
(
Invitrogen, USA
)

and transformed
14

into DH5α

chemically competent

E. coli
cells. The

recombinants were selected by
15

blue/white screening and recombinant plasmid DNA was isolated for further restriction
16

analysis and sequencing of the insert on a 3130XL Genetic analyzer
(
Applied
17

Biosystems, USA
)

using Big Dye® terminator V 3.1 cycle sequen
cing kit
(
Applied
18

Biosystem
s
, USA
)
. The raw sequence obtained was subjected to VecScreen
19

(
http://www.ncbi.nlm.nih.gov
)

to remove the vector contaminants. The edited and usable
20

sequences were analyzed using the BLAST
[
3
]
.

21

Phylogenetic analysis

22

FOR REVIEW
6



Closely rel
ated homolog
s were identified through phylogenetic analysis

[
37
]

by
1

comparing partial 16S rRNA gene sequences of
P. aeruginosa

SD12 with the non
-
2

redundant database o
f nucleotide

sequences deposited at NCBI web server
3

(
www.ncbi.nlm.nih.gov
)
, through Basic L
ocal Alignment Tool
(
BLAST
)

program

4

(
http://www/ncb.nlm.nih.gov/blast
)
.


5

Antagonistic activity

6


Pseudomonas aeruginosa

SD12 was tested for
in vitro

antagonism against
the
plant
7

pathogens
listed
in Table1
.
The screening was performed on potato
-
dextrose
-
agar

(
PDA
)

8

medium in triplicates. An agar plug
(
3mm diameter
)

taken from an actively growing
9

fungal culture was placed at one side on the surface of the PDA plate. After 48h, the
10

antagonist was streaked perpendicular to the agar plug on the opposite side towar
ds the
11

edge of plates. Plates inoculated with fungal agar plugs alone were used as control. The
12

plates were incubated at 28±2

o
C until fungal mycelia completely covered the agar
13

surface in control plate. The growth inhibition of different plant pathogens b
y SD12
14

strain was measured after 6 days of inoculation.

15

Test for h
ydrolytic enzymes, phosphatase, and HCN production

16


Production

of
proteases was estimated following the method of
Smibert and Kr
ie
g

17

[
3
5
]

while cellulases and pectinases were examined by the
method of Cattelan

et al
.
[
10
]
.
18

The phosphatase and HCN production were determined following the methods as
19

described by Pikovskaya

[
3
1
]

and

Kumar
et al.

[
24
]
,

respectively.

20

Siderophore production

21

FOR REVIEW
7



Production of siderophore was determined using Chrome azu
rol S
(
CAS
)

agar
1

method
[
3
4
]
. Briefly,

P. aeruginosa

SD12 inoculum’s was dropped onto the centre of
2

CAS plate. After incubation for 24h
-
48h at 28

o
C, siderophore

production was assessed
3

by formation of a distinct orange zone in the CAS plate.

The type of
s
iderophore

was

4

determined by using specific assay, viz. Arnow’s method for

c
atechol
ate

[
5
]

and Csaky
5

test for

hydroxamate

type

[
13
]
.


6

Influence
of P. aeruginosa SD
12 on

biomass

yield and N
, P and K
uptake in Isabgol


7



A

pot experiment was conducted to stu
dy the influence
of
P.

aeruginosa

isolates

8

of different origin on spikes
per
plant, dry matter yield and N, P

and K uptake in isabgol
9

(
Planatgo ovata
)
. Five
k
g of soil from the research farm of CIMAP, Lucknow after
10

sieving
(
< 2mm
)

was filled in
earthen pot
s

of 6L capacity
.
Soil was inoculated
11

individually
with 100g /pot

inoculum

(
1x10
-
5

cfu/ml
)

of

four strains of
P.

aeruginosa
as

12

follows:

P.

aeruginosa
SD12 collected from tannery waste mediated
(
Cr and other
13

heavy metal contaminated
)

soil, SD3, SD4 and SD6

collected from normal soil

of
14

CIMAP research farm at Lucknow
. Non
-
inoculated soil served as control.
Seeds of
15

i
sabgol were

sow
n in

2
nd

week
of December

and the crop was harvest at maturity
in

4
th

16

week

of March. Data
on yield

parameter
s

like spikes/plant,
and shoot and root dry
17

weight was recorded. Plant

sample
s

were

analyzed

for N
, P and K

content
[
21
]
.Total N
,
18

P and K

accumulation
was
estimat
ed

by their
concentration
(
%
)
and

dry weight. Data
19

was subjected to analysis of variance
(
ANOVA
)

and leas
t

signific
ant differences
(
LSD
)

20

were calculated using F
-
method
[
3
6
]
.

21

Effect of P.

aeruginosa SD12 on root rot and wilt disease of Pyrethrum

22

FOR REVIEW
8




Healthy
plants

of pyrethrum

which is highly susceptible to
R.

solani
AG4
(
2
)

1

were inoculated with 10ml bacterial spore suspe
nsion of
P.

aeruginosa
SD12
(
1 x 10
-
7

2

cfu
/ml
)

3
-
day
-
prior,

s
imultaneously

and

3
-
day
-
post of the

pathogen
,

R.

solani
by

3

following the method described by Alam
et al.

[
2
]
.

Plants i
n
oculated

alone
with

P.
4

aeruginosa
SD12

and
R
.

solani

served as control
. Plant
s were kept
in

greenhouse

at 25

5

o
C and 80
-
90%

relative

humidity.
Experiment was repeated twice with three replications

6

each time
. The disease reaction was assigned a rating on an arbitrary scale on 0
-
3
(
0,
7

healthy

plants with healthy roots 1, healthy

plant
s with small necrotic lesions on the
8

roots 2,
infected
plants showing wilting with large necrotic lesions on the roots 3,
9

infected
plants dying with dark brown roots
)
.


10

Production and extraction of antifungal metabolite

from P. aeruginosa SD12


11



Nutrient
broth was used for the production of the antifungal metabolite by
P.
12

aeruginosa

SD12. Batch fermentation was performed in 500ml Erlenmeyer flasks
13

containing 100ml of the growth medium which

was

inoculated by 1ml of bacterial
14

suspension
(
48 h
)

at pH 7 at 28

o
C and incubated for 3 days for total metabolite
15

production. The culture was centrifuged at 8000 rpm for 10 minutes at 6

o
C twice in
16

order to remove the bacterial cells. The supernatant was extracted with dichloromethane
17

three times. Dichloromethane extra
ct was evaporated to dryness under vacuum at 50

o
C.
18

The crude extract was tested for antagonistic activity against
Curvulaia andropogonis

19

causing leaf blight disease of
Java citronella

(
Cymbopogon winterianus
)
.

20

Isolation of antifungal metabolite

21


A

vacuum
liquid chromatography
(
VLC, 5X 20cm
)

column was packed with
22

TLC grade Al
2
O
3
(
150g
)

without binder.
E
xcellent separation was achieved due to fine
23

FOR REVIEW
9


particle size
(
average size 10 µm
)

of the Al
2
O
3.
The column was tightly packed using
1

vacuum followed by elution

of the column with a non polar solvent
(
hexane
)

to make
2

sure
that

column

was well packed
. Before loading the extract, glass column was
3

completely dried and then

6g of crude extract was dissolved in 10ml CHCl
3
and applied
4

uniformly onto top of the column w
ithout using vacuum
to form a uniform band. This
5

was followed by complete drying of the glass column under vacuum.

Gradient elution of
6

the column was carried out

with mixtures of hexane,

CHCl
3

and MeOH in increasing
7

order of polarity. Fractions of 100ml ea
ch were collected. A total of 61 fractions were
8

collected and pooled on the basis of their TLC profile into twelve fractions. Further
,

9

these pooled fractions were evaluated for their antifungal potential by bioautography test.
10

Out of 12 pooled fractions,
fraction 3 showed high antifungal activity but was slightly
11

impure, hence was further purified by preparative thin layer chromatography
(
PTLC
)

on
12

precoated Silica Gel 60
254
plates
(
20 X 20cm
,

Merck
)
. The PTLC plates were developed
13

in CHCl
3
: MeOH: 99.5:0.5

and after air drying visualized under UV light
(
254 nm
)

14

followed by selective spraying of the reference spot with Erlich reagent. The desired
15

band was scratched out of the PTLC plate and the metabolite was extracted with CHCl
3
:
16

MeOH:
(
95:5; 3x5ml
)
. Remova
l of the solvent under vacuum afforded the antifungal
17

metabolite PA
-
1
(
69mg
)
.

18

Structure elucidation of antifungal metabolite

19


The structure of antifungal metabolite was established by nuclear magnetic
20

resonance
(
NMR
)
. The
1
H and
13
C NMR spectrum were recor
ded in deuterated
21

chloroform and the chemical shifts are given in δ and ppm
(
parts per million
)

values
22

referenced to the chloroform solvent at δ 7.24 in
1
H and 77.4 ppm in
13
C NMR,
23

respectively as an internal standard. Structure elucidation of the metaboli
te was carried
24

FOR REVIEW
10


out in detail by various one and two
-
dimension NMR spectral studies such as DEPT
1

(
135
o
),

1
H
-
1
H COSY, HSQC and HMBC.

2

Results

3

Isolation and screening of fluorescent
P
seudomonas


4


Thirty five fluorescent pseudomonas isolates were obtained
on
PIA

from the tannery
5

waste polluted soil samples
of which
a

unique fluorescent
Pseudomonas

strain
6

designated as SD12

was

predominantly produced

.The strain

was further purified and
7

maintained on Luria Bertani
(
LB
)

slants at
-
20

o
C for subsequent studies.

T
he strain was
8

also deposited at Microbial Type
Culture Collection

(
MTCC
)
, IMTECH, Chandigarh,
9

India
(
http://www.mtcc.imtech.res.in
)

with accession number MTCC 106439.


10

Identification of bacterial strain


11


The predominant fluorescent pseudomonas obtained fr
om the tannery
waste
12

polluted soil samples was identified as

Pseudomonas aeruginosa

strain SD12 which was
13

aerobic, motile, non
-
spore
-
forming and Gram
-
negative. The strain produced a diffusible,
14

fluorescent light green pigment on KB. The strain grew at 25
-
4
2

o
C but not at
>

42

o
C.
15

The growth was optimum at pH 5.5
-
10 but inhibited at
<

pH 5.
5
. The strain tolerated
16

well up to 7% NaCl in the basal medium. It utilized citrate and produced catalase and
17

cytochrome oxidase. Nitrate reduction, urease, indole, levan
, gelatin liquification or
18

hydrogen sulfide was not produced. Methyl red and Voges
-
Proskauer reactions were
19

negative.
The strain did not utilize paraffins.
However, it

utilize
d

an array of carbon
20

sources

like

L
-
arabinose, galactose, glucose, fructose, xylo
se,

phenyl acetate, glycine

but
21

not mannitol, raffinose, salicin, sucrose, rhamanose, meso
-

inositol and lactose
.


22

FOR REVIEW
11


16S rRNA gene amplification sequencing and phylogenetic tree analysis

1


The 16S rRNA
sequence

(
600bp
)

was deposited in GenBank with accession
number
2

HQ260855. Comparison of the sequence by BLASTn
3

(
http://www.ncbi.nlm.nih.gov/blast
)

with the 16S rRNA sequences in database exhibited

4

100%

homology with
P
.
aeruginosa

(
EU849119
)
.
A phylogenetic

tree

is presented
5

(
Fig.1
)
.

6

Antagonistic activity

7


T
he strain SD12 showed strong antagonistic activity against wide range of plant
8

pathogenic fungi
which cause

diseases on different medicinal and aromatic plants
9

(
Table
1
)
.It produced highest antifungal activity a
gainst
Alternaria alternata, A. solani
10

and

Rhizoctonia solani

(
Fig.2a
)

which are cosmopolitan in distribution and causal
11

organisms for diseases on various crops

(
Table
1
)
. It also inhibited other test fungal
12

pathogens, viz.

Colletotrichum acutatum, Curvular
ia andropogonis, Fusarium
13

oxysporum, F. moniliforme
and

Pythium aphanidermatum

but its antagonistic activity
14

was comparatively less.

15

H
ydrolytic
enzymes, phosphatase

and HCN

16


The strain produced hydrolytic enzymes
(
proteases, pectinases and cellulases
)

17

(
Fig
.2
c
, Fig.2d, Fig.2e
)
, phosphatase
(
Fig.2
b
)
, and HCN
(
Fig.2
f
)
. It hydrolyzed various
18

substrates and produced clear zone.

19

Siderophore production and
characterization

20


In CAS assay,
P aeruginosa

SD12 produced a large orange zone into the medium
21

after 24h
(
Fi
g.3
)

indicating production of siderophore. The cell free culture filtrate of the
22

FOR REVIEW
12


SD12 strain used for Csaky test
[
13
]

developed a pink colour, indicating the presence of
1

hydroxamate siderophore. The absence of catechol
-
type siderophore was confirmed by
2

Arn
ow assay
[
5
]

where red
-
orange color was not developed.

3

Influence

of P. aeruginosa SD12 on biomass, N, P and K contents of
i
sabgol


4


Results presented in
Table

2

e
xhibit
s

a significant difference among different
5

strains of
P.

aeruginosa

with respect to gro
wth parameters
of isobgol
(
spikes/plant, dry
6

wt
.

of shoot and root
)

as well as N
, P

and K accumulation in shoot. Significantly higher
7

number of spikes and dry weight were recorded with
P.

aeruginosa

SD12
,

followed by
8

P.

aeruginosa

SD
-
3
,

collected from CIMA
P farm. The
other two

isolates
(
P.

aeruginosa

9

S
D
6,
P.

aeruginosa

SD
4
)

were

less effective with respect to enhancing

dry matter yield
10

and N
, P

and K accumulation. Dry weight of shoot
s

under SD
12 treatment was

about
11

3.78 times higher than the control
(
no ino
culation
)
.
The corresponding

increases under
P.

12

aeruginosa

SD6,
P.

aeruginosa

S
D
4 and
P.

aeruginosa

S
D
3 were 81%, 90% and 3.36
13

times as compared to control. Almost similar trend was observed with respect to
14

accumulation of N
, P

and K

in shoot
.

15

Influence

of

P.

aeruginosa SD12 on root rot and wilt disease of Pyrethrum

16



The results presented in Table
3

indicate

that
sole

treatment of
P
.

aeruginosa
SD12
17

significantly produced healthy plants while
R.

solani

caused
93.3%
disease

incidence

18

with an average score o
f 2.7 disease severity.
Though each of the treatments of
strain

19

SD12

produced significant

result
s

but
simultaneous treatment
of
strain
SD12 with
R.

20

solani
was highly effective
by producing 46.7% infected plants with 1.1 disease severity
21

(
Table
3
)
.

T
he
treat
ments 3
-
day
-
prior
and 3
-
day
-
post
produced
76.7% and 63.3%
22

FOR REVIEW
13


infected plants with 1.8 and 1.6 disease severity, respectively
.
In c
ontrol
,

with
R.

solani

1

AG4
inoculated plants
produced root rot and
wilt

symptoms with

dark brown roots.

2

Isolation of antifungal
m
etabolite produced by P. aeruginosa SD12

3


The crude extract
(
6g
)

obtained from SD12 strain was greenish in color which on
4

purification by vacuum liquid chromatography
(
VLC
)

yielded 69

mg of purified
5

yellowish metabolite exhibiting broad
-
spectrum antifungal

activity. Purity of the isolated
6

metabolite was checked by visualizing the Erlich reagent sprayed and activated TLC
7

plate under UV light at 254 and 365nm. Further
, single inhibition zone on
TLC revealed

8

that the isolated metabolite was pure with Rf 0.82.
Finally, purity of the isolated
9

metabolite was confirmed by its
1
H and
13
C NMR spectra. The metabolite was viscous
10

yellow, freely soluble in chloroform, methanol and diethyl ether and miscible in water.

11

Structure elucidation of antifungal metabolite

12



The

chemical structure of antifungal metabolite was characterized
13

spectroscopically. The molecular formula was determined by EI
-
MS and the basic
14

structure was elucidated by detailed
1
H and
13
C NMR spectra, as well as HSQC and
15

HMBC NMR spectrum.

16


The EI
-
MS att
ributed a molecular ion peak at m/z=196. In the
1
H NMR spectrum
17

(
Fig.
4
a
)
, a complex resonance in the δ 6.72 to 7.75 region indicated the presence of 7
18

aromatic protons, this was further supported by its
13
C NMR
(
PNDC, DEPT 135°
)

19

spectrum
(
Fig.
4
b&c
)

which s
howed presence of twelve carbon signals for five
20

quaternary
(C)

and seven methine
(
CH
)

carbons. Further
,

presence of downfield
21

quaternary carbon at 151.7 indicated the presence of phenolic hydroxyl group in the
22

molecule. Subtraction of 168
(
C
12
H
8
O
)

from th
e molecular weight
(
196
)

of the
23

FOR REVIEW
14


metabolite
(
196


168 = 28
)

suggested the presence of two nitrogen atoms in the
1

molecule. Thus, the molecular formula, C
12
H
8
N
2
O suggested the chemical structure of
2

the metabolite as hydroxyphenazine where the five quaternary

carbon atoms at 151.7,
3

143.8, 144.1, 141.2 and 134.7 ppm were assigned to C
-
1, C
-
4a, C
-
5a, C
-
9a, and C
-
10a,
4

respectively. Further
1
H
-
1
H
-

connectivity was studied by COSY
(
Fig.
4
d
)
.The up field
5

shift of C
-
2
(
108.9ppm
)

in HSQC
(
Fig.
4
e
)

indicated the presence

of hydroxyl group at
6

C
-
1, which was confirmed by HMBC
(
Fig.
4
f
)

and their correlations
(
Table
4

& Fig.
4
g
)
.
7

Finally, the structure of metabolite was confirmed as 1
-
hydroxyphenazine
(
Fig.
4
h
)

after
8

the detailed analysis of splitting pattern and comparison with

published data
[
1
]
.

9

Antimicrobial activity of isolated metabolite
(
1
-
hydroxyphenazine
)

10


The metabolite

1
-
hy
roxyphenazine obtained from
P
.

aeruginosa
SD12 has shown
11

antifungal

activity against

var
i
ous

plant pathog
ens
(
Table
1
)
.

T
he

metabolite was found
12

to
be highly effective against
R. solani
,
soil borne pathogen

as shown in

Fig.5
.

13

Discussion
s

14



P. aeruginosa

SD12, obtained from the tannery waste polluted area of Jajmau,
15

Kanpur
(
India
)

possesses antimicrobial activity and other traits responsible for plant
16

growth promotion

as reported in literature
[
6, 14
]
. Siderophores helps a particular
17

microorganism to compete against fungal pathogens for available iron and the role of
18

siderophores in control of disease has been well documented
[
1
]
. Further, solubilizatio
n
19

of tri
-
calcium phosphate
(
Ca
3
PO
4
)
by the formation of visible dissolution halo on
20

Pikovskaya’s agar and release of phosphorus into the culture medium
is the indication to

21

increase yield

of the crop by converting non

available form of phosphorus
(
P
)

to
22

av
ailable form
. The growth promoter effect in plants gives extra value to the isolate,
23

FOR REVIEW
15


since it may not only be increasing the bioavailability of one of the most important plant
1

nutrient like

P
, but also would release substance that have an antibiotic acti
vity and
2

enhanced

iron nutrition for the plant. It is evident from the results of plant growth
3

promotion under laboratory and greenhouse
conditions that

plants treated
with
P.
4

aeruginosa

SD12 accumulate more N, P and K in shoots than other treatments when
5

compared
with
un
-
inoculated control. The availability of phosphate helps in increasing
6

the biomass of plants
is also

reported by Patten and Glick,
[
30
]
.
The s
train SD12 also
7

exhibited the production of cellulases, pectinases and proteases. It
is

reported t
hat
8

phosphate solubilizing bacteria with celluloytic activity enhanced the mineralization and
9

decomposition of crop residues
[
16
]
.
The
biocontrol of tomato root rot caused by
10

Fusarium oxysporum

f. sp.
r
adicis
-
lycopersici

by
phenazine
-
1
-
carboxamide
-
producin
g
11

Pseudomonas chlororaphis
PCL1391

has been reported
[
11
]
. The strain SD12 and
its
12

metabolite,1
-
hydroxyphenazine
(
1
-
OH
-
PHZ
)

exhibited broad spectrum antifungal
13

activity against the plant pathogens
Alternaria alternata, A. solani, Bipolaris
14

australiensis
, Colletotrichum acutatum, Curvularia andropogonis, Fusarium oxysporum,
15

F. moniliforme, Pythium aphanidermatum
and

Rhizoctonia solani in vitro
(
Table1
)
. We
16

may conclude that

the strain

is responsible for inhibiting various plant pathogens

which

17

is

due to p
roduction of 1
-
hydroxyphenazine
(
1
-
OH
-
PHZ
)
. The pure yellowish brown
18

metabolite isolated from
P. aeruginosa

strain SD12 is soluble in chloroform and
19

methanol. It has shown antifungal activity against
Curvularia andropogonis
,
Bipolaris
20

austrialensis
, Altern
aria alternat
a
, A. solani,
C
olletotrichum acutatum

and
Fusarium
21

oxysporum
which have not been reported so far.
Therefore
,

we may conclude that the
22

antifungal activity against various important plant pathogens by 1
-
hydroxyphenazine is
23

the first report of it
s kind.

The spectral data of the
1
-
OH
-
PHZ

from
P. aeruginosa

SD12

24

FOR REVIEW
16


were identical to those earlier reported by Abken
et al.

[
1
]

and Saosoong
et al.
[
3
3
]
.

This
1

metabolite was earlier isolated from
P. aeruginosa

[
22
]

and

P. aeruginosa
TISTR 781
2

by
Saosoong
et

al.
[
3
3
]

but produc
tion of

siderophores, and phosphatase
by the strain
P.
3

aeruginosa

SD
12
that attribute
to
plant growth promotion
is also the first report.

4


Several
strains of
P.

aeruginosa
from clinical and agriculture soil samples have been
5

identified
[
20
, 26
, 9
]
.

P
.
aeruginosa
strains of clinical origin have been differentiated
6

from environmental strains as a result of their ability to use paraffins as sole carbon
7

source

[
2
7
]
.

In recent years,
P. aeruginosa
7NSK2 from barley rhizosphere and
P.
8

aerugino
sa

PNA1 from chickpea rhizosphere have been used as effective biocontrol
9

agents
[
20
,

4
]
.

10



We conclude that

P
. aeruginosa

SD12
is

a new strain from tannery waste
11

polluted soil
with production of 1
-
OH
-
PHZ,

cellulase, protease, HCN and other plant
12

growth pro
moting traits, such as siderophore, and phosphatase

which

enhance the
13

potential use of
this strain

as an effective
bioi
noculant for soil fertility, plant protection
14

and

promoting plant growth with reduced disease incidence.

15

Acknowledgements

16



S. Dharni, a

project assistant in Network Project, NWP
-
09 funded by
CSIR,

New
17

Delhi
, acknowledges financial support
.

Authors also thank

the

Director,
CIMA
P
,

18

Lucknow

for

encouragement

and facilities
.


19


20


21

References


22

FOR REVIEW
17


1.

Abken, H.

J.,
M
.

Tietze
,
J. Brodersen
,

S. Baumer
,
U.
Beifuss

and U.

Deppenmeier
.

1

1998. Isolation and characterization of methanophenazine and function of
2

phenazines in membrane
-
bound electron transport of
Methanosarcina mazei
Göl. J
.
3

Bacteriol
.
180
:

2027
-
2032.

4

2.

Alam, M.,
A.
Sattar,

Abdul
-
Khaliq,

A.
Samad

and
S.

P.

S.

Khanuja.

2006. A root rot
5

and wilt disease of pyrethrum
(
Chrys
anthemum

cinera
e
folium
)

caused by
6

Rhizoct
o
nia solani

AG
-
4 in the north Indian Plains.
Plant Pathol
.
55
:

301.

7

3.

Altschul, S.

F.
,
T.

L.

Madden,

A.

A. Schaffer, J.
Zhang,
Z.
Zhang
,

W.

Miller

and D.

8

J. Lipman. 1997.
Gapped BLAST and PSI
-
BLAST: a new generation of pr
otein
9

database search programs.
Nucleic Acids Res
.
25
:

3389
-
3402.

10

4.

Anjaiah, V.,
N. Koedam, B.

Nowak
-
Thompson,
J.

E.
Loper,
M.
Hofte,
J.

T.
11

Tambong

and P.
Cornelis
.
1998. Involvement o
f phenazines and anthranilate in the
12

antagonism of
Pseudomonas aeruginosa

PNA1 and Tn
5

derivatives toward
13

Fusarium

sp. and
Pythium

sp.
Mol. Plant
-
Microbe Interact
.

11
:

847
-
854.

14

5.

Arnow, L.

E. 1937. Colorimetric determination of the component of 3, 4
-
15

hydoxy
p
henyl
-
alanine
-
tyrosine mixture.

J. Bio
l
. Chem
.

118
:
531
-
537.

16

6.

Bakker, A.

W. and B. Schippers.
1987. Microbial cyanide production

in the
17

rhizosphere in relation to potato yield reduction

and
Pseudomonas

sp
p
.
-
mediated
18

plant growth
-

stimulation
. Soil Biol. Bioc
hem
.
19
:

451

457.

19

7.

Bergey, D.

H.
and R.

S. Breed.
1957. Bergey’s manual of determinative
20

bacteriology, Baltimore, Williams and Wilkins Co., USA.

21

8.

Bossis, E.,

P. Lemanceau
,

X.

Latour

and L. Gardan.
2000. The taxonomy of
22

Pseudomonas fluorescens
and
Pseudomon
as putida
:
C
urrent status and need for
23

revision.
Agronomie

20
:

51
-
63.

24

FOR REVIEW
18


9.

Buysens, S.,
K.
Heungens,

J.

Poppe
and M. Hofte.

1996. Invovement of pyochelin
1

and pyoverdin in suppression of
Pythium
-
induced damping
-
off by
Pseudomonas
2

aeruginosa
7NSK2.
Appl. Enviorn
. Micro
biol
.
62
:

865
-
871.

3

10.

Cattelan, A.

J., P.

G
Hartel

and
J
.

J
. Fuhrman
n

1999. Screening for plant growth
4

promoting rhizobacteria

(
PGPR
)

to promote early soybean growth.
Soil Sci. Soc.
5

Am
.

J.

63
:
1670
-
1680.

6

11.

Chin
-
A
-
Woeng, T.

F.

C.,

G.

V.

Bloemberg

and B.

J.

J
. Lugtenberg.
2003.
7

Phenazines and their role in biocontrol by
Pseudomonas
bacteria.
New Phytol
.

157
:

8

503
-
523.

9

12.

Chin
-
A
-
Woeng, T.

F.

C.,
G.V
.

Bloemberg,
A.

J.
v
ander Bij,
K.

M.

G
.

M.

v
an der
10

Drift,

J
.

Schripsema,
B
.

Kroon,
R.

J.
Scheffer,

C.

Keel
, P.

A.

H.

M. Bakker, H.
-
V.
11

Tichy, F.

J. deBruijn, J.

E. Thomas
-
Oates

and B.

J.

J. Lugtenberg
.
1998. B
iocontrol
12

by
phenazine
-
1
-
carboxamide
-
producing
Pseudomonas chlororaphis
PCL1391

of
13

tomato root rot caused by
Fusarium oxysporum

f. sp.
r
adicis
-
lycopersici
.
Mol
.

14

P
lant
-
Microbe Inter
act
.

11
:

1069
-
1077.

15

13.

Csaky,

T.

Z.

1948. On the estimation of bound hydroxylamine in biological
16

materials.
Acta

Chem
.

Scand
.

2
:

450
-
454.

17

14.

Glick, B.

R. 1995. The enhancement of plant growth by free
-
living bacteria.
Can
.

J.
18

Microbiol
.
41
:

109
-
117.

19

15.

Gurusiddaiah, S.,
D.

M
.

Weller,
A.

Sarkar

and
R.

J
.

Cook.

1986. Characterization
20

of an antibiotic produced by a strain of
Pseudomonas fluorescens

inhibitory to
21

Gaeumannomyces graminis

var.
tritici

and
Pythium

spp.
Antimicrob
.

Agents
22

Chemother
.

29
:

48
8

495.

23

FOR REVIEW
19


16.

Hammeda, B.,
Y
.

Harish Kumar Reddy
,
O.

P.
Rupela,
G.

N
.

Kumar

and

G.

Reddy
.

1

2006. Effect of carbon substartes on rock phosphate solubilization by bacteria from
2

composts and macrofauna.
Curr. Microbiol
.
53
:

298
-
302.

3

17.

Hammond, S.

M. and
P.

A
. Lambert.

1978. Antimicrobial action
s
,

p
p
. 4
-
9
.
Edward
4

Arnold Ltd., London
.


5

18.

Ha
a
s, D. and G. Defago.

2005. Biological control of soil
-
borne pathogens by
6

fluorescent pseudomonads.

Na
t.

Rev
.

Microbiol
.

4
:

307
-
319.

7

19.

Holliman, F.

G. 1969. Pigments of
Pseudomonas

species.

Part I. Structure and
8

synthesis of aeruginosin A.
J
.

Chem
.

Soc
.

Perkin
-
1
18
:

2514

2516.

9

20.

Iswandi, A.,
P.
Bossier,
J.
Va
n
denabe
e
le
and W. Verstraete.
1987. Effect of seed
10

inoculation with the rhizopseudomona
d

strain 7NSK2 on the root micro
biota

of
11

maize
(
Ze
a mays
)

and barley
(
Hordeum vulgare
)
.
Biol. Fert
il
. Soils
.

3
:

153
-
158.

12

21.

Jackson, M.

L.

1973.

Soil Chemical Analysis
.

Prentice Hall of India

Pvt. Ltd,

New
13

Delhi.

14

22.

Kerr, J.

R.,
G.

W.
Taylor,
A.

Rutman,
N
.

Hoiby,
P.

J.
Cole
and R. Wilson.
1999.
15

Pseudomonas aeru
ginosa
pyocyanin and 1
-
hydroxyphenazine inhibit fungal growth.

16

J. Clin.
Pathol
.

52
:

385
-
387.

17

23.

King, E.

O.,
M.

K
.

Ward

and

D.

E
Raney.

1954.

Two simple media for the
18

demonstration of pyocyanin and fluoresc
e
in.
J. Lab. Clin
.

Med
.

44
:

301
-
307.

19

24.

Kumar, R.

S.,

N.
Ayyadurai,

P.

Pandiaraja,

A.

V.

Reddy,
Y.
Venkateswarlu,

O.

20

Prakash
and N.

Sakthivel
.
2005. Characterization of antifungal metabolite produced
21

FOR REVIEW
20


by a new strain
Pseudomonas aeruginosa
PUPa3 that exhibits broad
-
spectrum
1

antifungal activity and biofertiliz
ing traits.
J. Appl. Microbiol
.

98
:

145
-
154.

2

25.

Ligon, J.

M.,
D.

S
.

Hill,
P.

E
.

Hammer,
N.

R
.

Torkewitz,
D
.

Hofmann,
H
-
J
.

Kempf

3

and K
-
H.
van Pee
.
2000. Natural products with antifungal activity from
4

Pseudomonas
bi
o
control bacteria.
Pest Manag. Sci
.

56
:

688
-
6
95.

5

26.

Mavordi, D.

V.,
R.

F
.

Bonsall,
S.

M.

Delaney,
M.

J
.

Soule
,
G
.

Phillips

and

L.

S
6

Thomashow.

2001. Functional analysis of genes for biosynthesis of pyocyanin and
7

phenazines
-
1
-
carboxamide from
Pseudomonas aeruginosa
PAO
1
.
J. Bacteriol
.
8

183
:

6454
-
6465.

9

27.

M
assengale, A.

R., R.

A.

Oll
ar
, S.J. Giordano, M.

S. Felder and S.

C. Aronoff.
10

1999. U
s
e of parrafims wax bating for identification of
Pseudomonas aeruginosa
11

clinical isolate
s
.
Diagn
.

Micr
obiol
.
I
nfec
t
.
D
is
.
35:

177.

12

28.

Mavrodi, D.

V.,
W.
Blankenfeldt
and
L.

S
.
Thomashow
.
2006. Phenazine
13

compound
s in fluorescent Pseudomonas

spp: Biosynthesis and regulation.
Ann
u
.
14

Rev. Phytopath
ol
.

44
:

417
-
445.

15

29.

Naik, P.

R.,
N
.

Sahoo
,

D
.

Goswami,
N
.

Ayyadurai

and
N
.

Sakthivel
.

2008. Genetic
16

and functional diversity among flu
orescent
p
seudomona
d
s isolated from the
17

rhizosphere of banana.
Microb
ial

Ecol
.

56
:
492
-
504.

18

30.

Patten, C.

L
.

and

B.

R
.

Glick
.

2002. Role of
Pseudomonas putida

indole acetic acid
19

in development of the host plant root system.
Appl. Environ. Microbiol
.

68
:

3795
-
20

3801.

21

31.

Pikovskaya, R.

I. 1948. Mobilization of phosphorus in soil in connection with
the
22

vital activity of some microbial species.
Mikrobiologi
y
a

17
:

363
-
370.

23

FOR REVIEW
21


32.

Rezzonico, F.,
M
.

Zala,
C.

Keel,
B
.

Duffy,
Y
.

Moenne
-
Loccoz

and
G.

Defago.

2007.
1

Is the ability o
f biocontrol
fluorescent pseudomonads

to produce the antifungal
2

metabolite 2, 4
-
diacetylphloroglucinol really synonymous with higher plant
3

protection?
New Phytol
.
173
:

861
-
872.

4

33.

Saosoong, K.,
W
.

Wongphathanakul,
C
.

Poasiri

and
C
.

Ruangviriyachai
.

2009.
5

Isol
ation and analysis of antibacterial substance produced from
P. aeruginosa
6

TISTR 781.
KKU Science
Journal
.
37
:

163
-
172
.


7

34.

Schwyn, B.,
and J.

B. Neilands.

1987. Universal chemical assay for the detection
8

and determination of siderophores.
Anal. Biochem
.
160
:

47
-
5
6
.

9

35.

Smibert, R.

M.
and
N. R.
Krieg
.

1994.
Phenotypic characterization, p
p
. 607

654.
In

10

P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg
(
ed
s.
)
, Methods for
11

G
eneral and
M
olecular
B
acteriology
,

American Society for Microbiology,
12

Washington, DC.

13

36.

Sokal,

R.

R.

and
F.

J.
Rholf.

1981. Biometry: The principle and practices of statics
14

in biological
r
esearch,
859 pp.

2
nd

Ed
, Freeman
,

San Francisco,

New

Y
ork
.

15

37.

Weisburg, W.

G.,
S.

M
.

Barns,

D.

A. Pelletier

and
D.

J
Lane
.
1991. 16S ribosomal
16

DNA amplificat
ion for phylogenetic study.
J. Bacteriol
.

173
:

697
-
703.

17

38.

Zhaung, X.,
J.

Chen,
H
.

Shim

and Z.

Bai
.
2007. New advances in plant growth
-
18

promoting rhizobacteria for bioremediation.

Environ.
Int
.

33
:

406
-
413.

19


20


21


22

FOR REVIEW
22


Table
1
.
Antagonistic activity of
Pseudomonas
aer
uginosa
SD12 against plant
1

pathogenic fungi

2


3


4


5


6


7


8


9


10


11


12


13


14


15

*
After 6 days

of inoculation
; #Average of 3 replications

16

17

Plant pathogenic fungi

*
,

#
Inhibition zone
(
mm
)

±

SE by

P.

aeruginosa
SD12

1
-
hydroxyphenazine

Alternaria alternata

A.

solani


Bipolaris australiensis

Colletotrichum acutatum

Curvularia andropogonis

Fusarium oxy
sporum

F. moniliforme

Pythium aphanidermatum

Rhizoctonia solani


23.0
+

0.0

21.9
+

0.11

17.3
+

0.57

12.0
+

0.0

15.8
+

0.28

12.0
+

0.0

9.3
+

0.57

5.3
+

0.57

19.3.0
+

1.15


24.8 ± 0.16

20.2 ± 0.16

19.7 ± 0.33

10.2 ± 0.16

16.5 ± 0.28

10.0 ±0 .28

10.5 ± 0.28

3
.3 ± 0.16

17.7 ± 0.16


FOR REVIEW
23


Table.
2
.

Increase in biomass yield and N, P, and K uptake in

isabgol
(
Plantgo ovata
)

by
1

P
seudomonas
.

aeruginosa

SD12

2

All data are average of 5 replications

3


4


5


6


7


8


9


10


11


12


13


14


15


16


17


18


19


20

Treatments

Spikes/plant

Shoot dry
wt in wt.
(
g/pot
)

Root dry
wt in wt.
(
g/pot
)

Total nutrient uptake
(
mg/pot
)



N P

K

P.aeruginosa
SD
-
3

P.aeruginosa
SD
-
4

P.aeruginosa
SD
-
6

P.aeruginosa

SD
-
12

Control

LSD
(
P=0.05
)

70.0

58.6

57.3

87.0

40.0

10.8

10.30

5.33

5.06

13.37

5.23

2
.80

1.38

0.76

0.73

1.64

0.43

0.12

238.7

90.1

94.1

363.6

58.1

36.6

70.4

32.5

29.8

104.3

30.9

12.9

178.5

62.9

60.8

310.0

52.3

34.9

FOR REVIEW
24



Table
3
.
Influence
of
P
seudomonas

aeruginosa
SD12 on root rot and wilt

disease of

1

p
yrethrum

2


3

*
calculated on the basis of disease reactions described in materials & methods

4


5


6


7


8


9


10


11


12


13


14

15

Treatments

Plants infected
(
%
)

Disease severity*

Control:


P

.

aeruginosa

SD12


R. solani

P.

aeruginos
a SD12 +
R.

solani


3
-

day
-
prior
(
P.

aeruginos
a SD12
)


Simultaneous


3
-
day
-
post
(
P.

aeruginos
a SD12
)

LSD
(
P=0.05
)


0

93.3


7
6.7

46.7

63.3

5.4


-

2.7


1.8

1.1

1.6

0.2

FOR REVIEW
25


Table
4
.
1
H,
13
C NMR data and HMBC Correlations of 1
-
hydroxyphenazine
produced


1


by


P
seudomonas
aeruginos
a

SD12

2


3


4


5


6


7


8


9


10


11


12


13



14


15


16


17


18


19


20

1
H Protons

13
C
(
carbon
)

HMBC Correlation with
carbons


C
1

151.7


H
2
6.72

C
2

108.9

C
-
1,C
-
3 and C
-
10a

H
3

7.26

C
3

119.9

C
-
1 and C
-
4a

H
4

7.24

C
4

131.9

C
-
2 and C
-
10a


C
4a

143.8



C
5a

144.1


H
6

7.36

C
6

130.8

C
-
5a, C
-
7 and C
-
9a

H
7

7.70

C
7

129.2

C
-
5a and C
-
6

H
8

7.32

C
8

130.5

C
-
9 and C
-
9a

H
9

7.75

C
9

129.7

C
-
8 and C
-
9a


C
9a

141.2



C
10a

134.7


FOR REVIEW
26


Legends:

1

Fig.1:

Phyl
ogenetic tree analysis of
P. aeruginosa
SD12
using 16S rRNA partial
2

sequence. The phylogenetic tree was developed with CLUSTAL W program and
3

accession numbers are indicated in
parentheses.

4

Fig.2:

P. aeruginosa

SD12 showing antagonistic activity against
Rhiz
octonia solani
(
a
)
,

5

tri
-
calcium phosphate solubilization in
Pikovskaya’s agar medium
after 72 h

(
b
)
,
6

production of protease
(
c
)

on skim milk agar after 48 h, pectinase
(
d
)

on M9 agar
7

medium amended with 5g l
-
l

pectin after 48 h
,
c
ellulase

(
e
)

on M9 medium agar
8

amended with 10g l
-
1
cellulose and 0.02% Congo red after 3 days, and HCN
(
f
)

9

after 24 h on King’s B agar supplemented with glycine
(
4.4g l
-
1
)

as indicated by
10

discoloration of filter paper impregnated with picric acid
(
0.5%
)

and sodium
11

ca
rbonate
(
2%
)
.

12

Fig.3:

Development of orange zone in CAS agar plate due to production of siderophore
13

by
P. aeruginosa
SD12.

14

Fig.4:

Structure elucidation of metabolite produced by
P.aeruginosa
SD12: a
)

1
H
-

15

NMR , b
)

13
C
-
NMR, c
)

DEPT 135
o
, d
)

COSY
-
NMR, e
)

H
SQC
-
NMR, f
)

16

HMBC
-
NMR, g
)

HMBC correlations, h
)

structure of isolated metabolite, 1
-
17

hydroxyphenazine.

18

Fig.

5
: Inhibition of
R
hizoctonia

solani
by
1
-
hydroxyphenazine

at 40µg/disc

19

FOR REVIEW
1




Fig. 1







FOR REVIEW
2

























Fig.2











Fig.
3


a

b

d

c

e

f

FOR REVIEW
3



4a

4b

4c

4d

FOR REVIEW
4
























Fig. 4







4g

4h

4e

4f

FOR REVIEW
5










Fig. 5

FOR REVIEW
1


Supplimentry Material

The partial 16S rRNA nucleotide sequence data of
P. aeroginosa
SD 12 (600 bp)
submitted to NCBI Genbank is attached as
follows
:

>Pseudomonas sp.SD12, 16S rRNA, partial sequence

GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGA
GCGGATGAAGGGAGCTTGCTCCT
GGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTCCGGAAACGGGCGCTAATA
CCGCATACGTCCTGAGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG
GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGA
CACGGTC
CAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGA
AGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAGGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAG
AATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAA
GCGCGCGTA
GGTGGTTCAGCAAGTTGGATGTGAAATCCCC

Multiple Sequence Alignment of studied sequences through CLUSTAL W 2.
1

P.aeruginosa_AB449026
--------------------------------------------------

P.aeruginosa_EU747695
----------------------------------------
----------

P.aeruginosa_GU566322
--------------------------------------------------

P.aeruginosa_FN433043
--------------------------------------------------

P.aeruginosa_EF062513
--------------------------------------------------

P.aeruginosa_GU269267
--------------------------------------------------

Pseudomonas_spp._EU352760
--------------------------------------------------

P.aeruginosa_FJ665510
--------------------------------------------------

P.aerugin
osa_EF062512
--------------------------------------------------

P.aeruginosa_EF062511
--------------------------------------------------

Pseudomonas_spp._EU099379
--------------------------------------------------

P.aeruginosa_GU3392
38
--------------------------------------------------

P.aeruginosa_GU447238
----------------------------------------
CTCGCGATGC 10

P.aeruginosa_FJ227280
--------------------------------------------------

P.aeruginosa_GU447237

CGCGATGCATCTAGATTAGAGTTTGATCCTGGCTCAGGAAGTCGTAACAA 50

P.aeruginosa_SD12

--------------------------------------------------

P.aeruginosa_EU849119
--------------------------------------------------





P.aeruginosa_AB449026
---------
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 41

P.aeruginosa_EU747695
---------
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 41

P.aeruginosa_GU566322
-----
----
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 41

P.aeruginosa_FN433043
----------
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

P.aeruginosa_EF062513
----------
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

P.aeruginosa_GU269267
-
CCGGA
TCCAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 49

Pseudomonas_spp._EU352760
---------
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 41

P.aeruginosa_FJ665510
----------
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

P.aeruginosa_EF062512
-------
---
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

P.aeruginosa_EF062511
----------
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

Pseudomonas_spp._EU099379
------
ATTAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 44

P.aeruginosa_GU339238
--------
TAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 42

P.aeruginosa_GU447238 ATCTAGATTAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 60

P.aeruginosa_FJ227280
------
ATTAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 44

P.aeruginosa_GU447237 GGTAGCCGT
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 100

P.aeruginosa_SD12
----------
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 40

P.aeruginosa_EU849119
-------
ATAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCC 43



****************************************


P.aeruginosa_AB449026 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 91

P.aeruginosa_EU747695 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 91

P.aeruginosa_GU566322 TAACACATGCAA
GTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 91

P.aeruginosa_FN433043 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

P.aeruginosa_EF062513 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

P.aeruginosa_GU269267 TAACACATGCAAG
TCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 99

Pseudomonas_spp._EU352760 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 91

P.aeruginosa_FJ665510 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

FOR REVIEW
2


P.aeruginosa_EF062512 TAACACATGCAAGT
CGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

P.aeruginosa_EF062511 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

Pseudomonas_spp._EU099379 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 94

P.aeruginosa_GU339238 TAACACATGCAAGTC
GAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 92

P.aeruginosa_GU447238 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 110

P.aeruginosa_FJ227280 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 94

P.aeruginosa_GU447237 TAACACATGCAAGTC
GAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 150

P.aeruginosa_SD12 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 90

P.aeruginosa_EU849119 TAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGATTCAGCG 93


***************
***********************************


P.aeruginosa_AB449026 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 141

P.aeruginosa_EU747695 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 141

P.aeruginosa_GU566322 GCGGACGGGTGAGTAA
TGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 141

P.aeruginosa_FN433043 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

P.aeruginosa_EF062513 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

P.aeruginosa_GU269267 GCGGACGGGTGAGT
AATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 149

Pseudomonas_spp._EU352760 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 141

P.aeruginosa_FJ665510 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

P.aeruginosa_EF062512 GCGGACGGGTGA
GTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

P.aeruginosa_EF062511 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

Pseudomonas_spp._EU099379 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 144

P.aeruginosa_GU339238 GCGGACGGGT
GAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 142

P.aeruginosa_GU447238 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 160

P.aeruginosa_FJ227280 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 144

P.aeruginosa_GU447237 GCGGACGG
GTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 200

P.aeruginosa_SD12 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACG 140

P.aeruginosa_EU849119 GCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATA
-
CG 142


******
***************************************** **


P.aeruginosa_AB449026 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 191

P.aeruginosa_EU747695 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 191

P.aeruginosa_GU566322 TCCGGAA
ACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 191

P.aeruginosa_FN433043 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

P.aeruginosa_EF062513 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

P.aeruginosa_GU269267 TCCGG
AAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 199

Pseudomonas_spp._EU352760 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 191

P.aeruginosa_FJ665510 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

P.aeruginosa_EF062512 TCC
GGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

P.aeruginosa_EF062511 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

Pseudomonas_spp._EU099379 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 194

P.aeruginosa_GU339238 T
CCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 192

P.aeruginosa_GU447238 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 210

P.aeruginosa_FJ227280 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 194

P.aeruginosa_GU447237

TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 250

P.aeruginosa_SD12 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 190

P.aeruginosa_EU849119 TCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGG 192



**************************************************


P.aeruginosa_AB449026 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 241

P.aeruginosa_EU747695 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 241

P.aeruginosa_GU566322

ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 241

P.aeruginosa_FN433043 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

P.aeruginosa_EF062513 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

P.aeruginosa_GU269267

ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 249

Pseudomonas_spp._EU352760 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 241

P.aeruginosa_FJ665510 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

P.aeruginosa_EF062512

ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

P.aeruginosa_EF062511 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

Pseudomonas_spp._EU099379 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 244

P.aeruginosa_GU339238

ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 242

P.aeruginosa_GU447238 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 260

P.aeruginosa_FJ227280 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 244

P.aeruginosa_GU447237

ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 300

P.aeruginosa_SD12 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 240

P.aeruginosa_EU849119 ATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTG 242



**************************************************


P.aeruginosa_AB449026 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 291

P.aeruginosa_EU747695 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 291

P.aeruginosa_GU56632
2 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 291

P.aeruginosa_FN433043 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

P.aeruginosa_EF062513 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

FOR REVIEW
3


P.aeruginosa_GU269
267 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 299

Pseudomonas_spp._EU352760 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 291

P.aeruginosa_FJ665510 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

P.aeruginosa_EF0
62512 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

P.aeruginosa_EF062511 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

Pseudomonas_spp._EU099379 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 294

P.aeruginosa_G
U339238 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 292

P.aeruginosa_GU447238 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 310

P.aeruginosa_FJ227280 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 294

P.aeruginosa
_GU447237 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 350

P.aeruginosa_SD12 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 290

P.aeruginosa_EU849119 GTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGAT 292



**************************************************


P.aeruginosa_AB449026 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 341

P.aeruginosa_EU747695 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 341

P.aeruginos
a_GU566322 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 341

P.aeruginosa_FN433043 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

P.aeruginosa_EF062513 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

P.aerugin
osa_GU269267 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 349

Pseudomonas_spp._EU352760 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 341

P.aeruginosa_FJ665510 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

P.aerug
inosa_EF062512 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

P.aeruginosa_EF062511 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

Pseudomonas_spp._EU099379 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 344

P.aer
uginosa_GU339238 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 342

P.aeruginosa_GU447238 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 360

P.aeruginosa_FJ227280 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 344

P.a
eruginosa_GU447237 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 400

P.aeruginosa_SD12 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 340

P.aeruginosa_EU849119 GATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAG 342



**************************************************


P.aeruginosa_AB449026 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 391

P.aeruginosa_EU747695 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 391

P.
aeruginosa_GU566322 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 391

P.aeruginosa_FN433043 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 390

P.aeruginosa_EF062513 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 390

P.aeruginosa_GU269267 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 399

Pseudomonas_spp._EU352760 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 391

P.aeruginosa_FJ665510 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 39
0

P.aeruginosa_EF062512 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 390

P.aeruginosa_EF062511 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 390

Pseudomonas_spp._EU099379 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG
394

P.aeruginosa_GU339238 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 392

P.aeruginosa_GU447238 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 410

P.aeruginosa_FJ227280 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGC
G 394

P.aeruginosa_GU447237 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 450

P.aeruginosa_SD12 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCG 390

P.aeruginosa_EU849119 CAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCC
GCG 392


**************************************************


P.aeruginosa_AB449026 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 441

P.aeruginosa_EU747695 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAA
GG 441

P.aeruginosa_GU566322 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 441

P.aeruginosa_FN433043 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 440

P.aeruginosa_EF062513 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGG
AAGG 440

P.aeruginosa_GU269267 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 449

Pseudomonas_spp._EU352760 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 441

P.aeruginosa_FJ665510 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGA
GGAAGG 440

P.aeruginosa_EF062512 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 440

P.aeruginosa_EF062511 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 440

Pseudomonas_spp._EU099379 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGG
GAGGAAGG 444

P.aeruginosa_GU339238 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 442

P.aeruginosa_GU447238 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 460

P.aeruginosa_FJ227280 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTT
GGGAGGAAGG 444

P.aeruginosa_GU447237 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGG 500

P.aeruginosa_SD12 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAGGG 440

P.aeruginosa_EU849119 TGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAG
TTGGGAGGAAGG 442


*********************************************** **


P.aeruginosa_AB449026 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 491

P.aeruginosa_EU747695 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACA
GAATAAGCACC 491

FOR REVIEW
4


P.aeruginosa_GU566322 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 491

P.aeruginosa_FN433043 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 490

P.aeruginosa_EF062513 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAA
CAGAATAAGCACC 490

P.aeruginosa_GU269267 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 499

Pseudomonas_spp._EU352760 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 491

P.aeruginosa_FJ665510 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACC
AACAGAATAAGCACC 490

P.aeruginosa_EF062512 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 490

P.aeruginosa_EF062511 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 490

Pseudomonas_spp._EU099379 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTA
CCAACAGAATAAGCACC 494

P.aeruginosa_GU339238 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 492

P.aeruginosa_GU447238 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 510

P.aeruginosa_FJ227280 GCAGTAAGTTAATACCTTGCTGTTTTGACGT
TACCAACAGAATAAGCACC 494

P.aeruginosa_GU447237 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 550

P.aeruginosa_SD12 GCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACC 490

P.aeruginosa_EU849119 GCAGTAAGTTAATACCTTGCTGTTTTGAC
GTTACCAACAGAATAAGCACC 492


**************************************************


P.aeruginosa_AB449026 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 541

P.aeruginosa_EU747695 GGCTAACTTCGTGCCAGCAGCCGCGGTAAT
ACGAAGGGTGCAAGCGTTAA 541

P.aeruginosa_GU566322 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 541

P.aeruginosa_FN433043 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 540

P.aeruginosa_EF062513 GGCTAACTTCGTGCCAGCAGCCGCGGTA
ATACGAAGGGTGCAAGCGTTAA 540

P.aeruginosa_GU269267 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 549

Pseudomonas_spp._EU352760 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 541

P.aeruginosa_FJ665510 GGCTAACTTCGTGCCAGCAGCCGCGG
TAATACGAAGGGTGCAAGCGTTAA 540

P.aeruginosa_EF062512 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 540

P.aeruginosa_EF062511 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 540

Pseudomonas_spp._EU099379 GGCTAACTTCGTGCCAGCAGCCGC
GGTAATACGAAGGGTGCAAGCGTTAA 544

P.aeruginosa_GU339238 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 542

P.aeruginosa_GU447238 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 560

P.aeruginosa_FJ227280 GGCTAACTTCGTGCCAGCAGCC
GCGGTAATACGAAGGGTGCAAGCGTTAA 544

P.aeruginosa_GU447237 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 600

P.aeruginosa_SD12 GGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAA 540

P.aeruginosa_EU849119 GGCTAACTTCGTGCCAGCAG
CCGCGGTAATACGAAGGGTGCAAGCGTTAA 542


**************************************************


P.aeruginosa_AB449026 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 591

P.aeruginosa_EU747695 TCGGAATTACTGGGCGTAAAG
CGCGCGTAGGTGGTTCAGCAAGTTGGATG 591

P.aeruginosa_GU566322 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 591

P.aeruginosa_FN433043 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

P.aeruginosa_EF062513 TCGGAATTACTGGGCGTAA
AGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

P.aeruginosa_GU269267 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 599

Pseudomonas_spp._EU352760 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 591

P.aeruginosa_FJ665510 TCGGAATTACTGGGCGT
AAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

P.aeruginosa_EF062512 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

P.aeruginosa_EF062511 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

Pseudomonas_spp._EU099379 TCGGAATTACTGGGC
GTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 594

P.aeruginosa_GU339238 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 592

P.aeruginosa_GU447238 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 610

P.aeruginosa_FJ227280 TCGGAATTACTGG
GCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 594

P.aeruginosa_GU447237 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 650

P.aeruginosa_SD12 TCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 590

P.aeruginosa_EU849119 TCGGAATTACT
GGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATG 592


**************************************************


P.aeruginosa_AB449026 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 641

P.aeruginosa_EU747695 TGAAATCCCCGG
GCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 641

P.aeruginosa_GU566322 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 641

P.aeruginosa_FN433043 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 640

P.aeruginosa_EF062513 TGAAATCCCC
GGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 640

P.aeruginosa_GU269267 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 649

Pseudomonas_spp._EU352760 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 641

P.aeruginosa_FJ665510 TGAAATCC
CCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 640

P.aeruginosa_EF062512 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 640

P.aeruginosa_EF062511 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 640

Pseudomonas_spp._EU099379 TGAAAT
CCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 644

P.aeruginosa_GU339238 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 642

P.aeruginosa_GU447238 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 660

P.aeruginosa_FJ227280 TGAA
ATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 644

P.aeruginosa_GU447237 TGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 700

P.aeruginosa_SD12

TGAAATCCCC
----------------------------------------

600

P.aeruginosa_EU849119 TG
AAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAG 642


**********


FOR REVIEW
5












Figure :
-

Biocontrol of root rot and wilt disease of
Pyrethrum
caused by
Rhizoctonia
solani
:

(a)

P.

aeruginosa

SD12, (b)

R.soalni
,

(c) (simultaneous), (d)
P.

aeruginosa
SD12
(3
-
day
-

prior)

+
R.solani









c

a

d

b