SupplementalMaterial_R2x (113.0Kb) - Dryad

codinstrumentΒιοτεχνολογία

23 Οκτ 2013 (πριν από 3 χρόνια και 9 μήνες)

92 εμφανίσεις

Supplemental Material

1
)

Total RNA was extracted from the atypoid mygalomorph
spiders
Antrodiaetus
riversi

(O. P.
-
Cambridge, 1883)
an
d
Megahexura fulva

(Chamberlin, 1919).

RNA was shipped to the Genomic
Services Lab at
the Hudson
Alpha

Institute for Biotechnology

(
http://www.hudsonalpha.org/gsl/
)
where non
-
normalized libraries were prepared using the Illumina TruSeq RNASeq kit, and
sequenced as 50
-
bp paired
-
end reads using Illumina HiSeq

technology. Illumina sequences were
assembled
de novo

using Trinity software (
Grabherr et al 2011
). Assembled transcriptomes of
A
ntrodiaetus
and
Megahexura

were combined, and in Geneious Pro (
http://www.geneious.co
m/
)
searched against a protein set of single copy, single exon genes (see Hedin et al 2012) derived
from the arachnid

Ixodes scapularis.
Proteins shared among these three taxa that also lacked
evidence for paralogy (i.e.,
only

a single transcript in mygalo
morph taxa), and showed
preliminary evidence for nucleotide divergence between

A
ntrodiaetus

and
Megahexura
, were
targeted for PCR primer design. Gene regions were further assayed for PCR primer success and
sequence variation on a small panel of
A. thompson
i

group genomics. Two gene regions showed
adequate variation in the
A. thompsoni

group and were pursued further:


Mid1
-
interacting protein,
Ixodes
gene ISCW001223, forward primer 5’
-
GCAGCTATGTCGCACACGCAGGAACGC


3’, reverse primer 5’
-
ATGACAGAAAGTCAGCAGAAT
CTGCAAG


3’.


Mid1 primers amplify gene regions in
Aliatypus

that
BLAST to the Mid1
-
interacting protein in
Ixodes
.


Methylmalonyl coenzyme A mutase,
Ixodes

gene ISCW020522, forward primer 5’
-

ATGTAGGTATGGCTGGAGTTGCTGTAG


3’, reverse primer 5’
-

CAGCAGCCATGGCTTCTACAGTTGTCC


3’.


MethylMal primers amplify gene regions in
Aliatypus

that do not
in turn
BLAST to the
MethylMal protein in
Ixodes
; this gene region

was however retained as an anonymous nuclear
gene region for phylogenetic analysis

(and is thus referred to as anonymous)
.


Both genes were PCR amplified using Platinum
Taq

from Life Technologies, using a touchdown
PCR protocol as follows: 94C at 1 min, 60
C at 1
:
15 min, 72C at 1
:
30 min (X10 cycles, dropping
annealing temperature
-
0.5C per cycle); 94C at 15 sec, 55C at 1
:
15 min, 72C at 1
:
30 min (X 30
cycles). PCR products were purified on Millipore plates, and sequenced in both directions using
Sanger techno
logy at Macrogen USA (http://www.macrogenusa.net/).



2
)

Replicated subsampling for spedeSTEM was used for most OTUs; however, subsampling was
nonrandom with alleles selected based upon genetic distance (i.e., alleles that were most distantly
related with
in an OTU were chosen). A genetic distance matrix was estimated in PAUP*, with
subsampling as follows (provinces not mentioned were not subsampled). CR


both alleles were
sampled for RedHillRd (o) since it is heterozygous at EF
-
1γ nDNA and four alleles mi
nimum are
required for spedeSTEM. TR


sampling followed n
-

1 (with n being total number of alleles) for
each province, except San Gabriel (m) contained both alleles. SN


sampling followed n
-

1,
although Piute (c) contained both alleles. In the combined

analysis (all provinces), three alleles
were subsampled from each OTU, with the exception of south Coast Ranges, which contained
both alleles (2).


3)

Probability of observing monophyly for Frazier and Sierra was calculated using equation 6 in
Roserberg (
2007). Equation 6 sums the probabilities for
at least

that number of loci as
monophyletic (for example, if you specified four out of five loci as monophyletic, you would
also calculate for five out of five and sum the probabilities), but we calculated for the specific
number of observations of monophyly (i.e
., only for four out of five loci). For both calculations,
we assumed 27 gene lineages within a locus,
with equal sample sizes for

all six loci. For Frazier,
the probability was calculated for five alleles as monophyletic, and 22 alleles outside of that
gr
oup. For Sierra, the probability was calculated for four alleles as monophyletic, with 23 alleles
outside of that group.


R
eferences
:


Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L,
Raychowdhury R, Zeng Q, Chen Z, Mauce
li E, Hacohen N, Gnirke A, Rhind N, di Palma F,
Birren BW, Nusbaum C, Lindblad
-
Toh K, Friedman N, Regev A.
2011.
Full
-
length
transcriptome assembly from RNA
-
seq data without a reference genome.
Nat Biotechnol.
15;29(7):644
-
52
. doi: 10.1038/nbt.1883.



Hedin M, J Starrett, S Akhter, AL Schönhofer and JW Shultz. 2012. Phylogenomic resolution of
Paleozoic divergences in harvestmen (Arachnida, Opiliones) via analysis of next
-
gene
ration
transcriptome data.
PLoS ONE 7(8): e42888. doi:10.1371/journal.pone.0042888


Rosenberg N.A. 2007.
Statistical tests for taxonomic distinctiveness from observations of
monophyly. Evolution. 61:317
-
323.