n = 69

calendargrumpyΒιοτεχνολογία

14 Δεκ 2012 (πριν από 7 χρόνια και 6 μήνες)

350 εμφανίσεις

NRAMP1 GENE POLYMORPHISM IN PATIENTS
WITH RHEUMATOID ARTHRITIS IN PAKISTANI
POPULATION

1 Department of Animal Sciences, Quaid
-
i
-
Azam University, Islamabad

2 Institute of Biomedical and Genetic Engineering, KRL Hospital, Islamabad

Hafsah
Muhammad Chishti
1,2
,
Abdul Hameed
2
,
Samina
Jalali
1
,
Muhammad Ajmal
2
,
M. Nasir Malik
2

RHEUMATOID ARTHRITIS


Disease Characteristics


Prevalence


Symptoms


Diagnosis


Causes


Environmental


Genetic


Treatment

CANDIDATE GENES FOR RA


HLA
-
DRB1


PTPN22


TRAF1
-
C5


CTLA


PADI4


STAT4


NRAMP1/ SLC11A1

NRAMP1 / SLC11A1: THE GENE


Natural Resistance Associated Macrophage Protein 1


Located on chromosome 2q35


Approximately 14 kb in length


Contains 15 exons


Has been linked to many infectious and autoimmune diseases


Regulates and also regulated by cellular iron levels

NRAMP1: THE PROTEIN


Originally described in mice for its roles in regulating resistance and
susceptibility to infectious agents.


Expressed in macrophages ,
neutrophils

and in bone marrow derived
dendritic

cells


highly hydrophobic integral membrane protein


12
transmembrane

domains


transport activity and ion channel


Can resist several intracellular pathogenic microorganisms

FUNCTIONS OF NRAMP1 PROTEIN


Nrampl

regulates in early pathway of


macrophage activation


activation for antimicrobial activity


These functions are of potential importance in the induction or
maintenance, or both, of autoimmune disease.


An animal resistant to intracellular pathogens may be susceptible to
autoimmune disease.

NRAMP1 GENE POLYMORPHISMS


Nine sequence variants reported in the NRAMP1 gene


one (GT)n in the 5’ region (promoter region)


three in
introns
, one 4
-
bp deletion in the 3’ UTR (1729+55 del4; 55
nt

3’ to the last codon in exon 15)


The remaining four variants are in the coding region:


two silent substitutions (274 C/T, 823 C/T)


two
missense

mutations (A318V, D543N)

NRAMP1 GENE POLYMORPHISMS
CONTINUED…

D543N



At codon 543 in exon 15


G or A at nucleotide 1703


G coding for Aspartic Acid


A coding for Asparagine


A318V


At codon 318 in exon 9


C or T at nucleotide 1029


C coding for Alanine


T coding for Valine

274C/T



At codon 66 in exon 3


C or T at position 274


silent nucleotide substitution


coding of Phenylalanine

OBJECTIVES


To investigate the NRAMP1 gene polymorphism(s) in Pakistani
population.



To study the association of NRAMP1 gene polymorphisms (D543N,
A318V, 274C/T) in susceptibility to RA.

MATERIALS AND METHODS


Blood samples, 6


8 ml


112 Clinically diagnosed RA patients


69 healthy unrelated volunteer donors

Sample Collection


Standard phenol
-
chloroform / Organic method of DNA
Extraction

DNA Extraction


PCR Amplification of three polymorphisms under
study


Three sets of specific primers used


PCR Amplification


Digestion of PCR products using specific restriction
enzymes


Manufacturer’s instructions followed

Restriction Digestion


3% Agarose gel electrophoresis


Gel visualization using UV illumination system


Gel Documentation

Gel Electrophoresis
and Documentation

PRIMERS SEQUENCES, ANNEALING TEMPERATURE AND PCR
PRODUCT SIZES

Polymorphism

Primer Sequence 5’
-
3’

Annealing Temp.

PCR Product Size

D543N

GCATCTCCCCAATTCATGGT

55º C

240
bp

AACTGTCCCACTCTATCCTG

A318V

TCCTTGATCTTCGTAGTCTC

50º C

232 bp

GGCTTACAGGACATGAGTAC

274 C/T

TGCCACCATCCCTATACCCAG

57º C

216 bp

TCTCGAAAGTGTCCCACTCAG

MASTER MIX PREPARATION FOR RESTRICTION
ENZYME DIGESTION

Polymorphism

Components

Final Conc.
Required

Required
Volume/
Rxn

(15µl
)

Volume (µl)
required for 181
Rxns.

D543N

Deionized Water

-

12.0

2172

Buffer A (Boeh. M.), 10X

1X

2.0

362

Ava II (Boeh. M.), 5U/µl

5 Units

1.0

181

A318V

Deionized Water

-

12.5

2262.5

Buffer 10X

1X

2.0

362

Fnu4HI,
5U/µl

2.5 Units

0.5

90.5

274 C/T

Deionized Water

-

12.2

2208.2

Buffer 4, 10X

1X

2.0

362

Mnl

I,
5U/µl

3 Units

0.6

108.6

BSA, 100X (10mg/ml)

1X (100µg/ml)

0.2

36.2

STATISTICAL ANALYSIS


Allele frequency calculated on the basis of Hardy
-
Weinberg Equilibrium equation using
formulae:

p² + 2pq + q² = 1


&

Allele frequency =
No. of that allele in study group





Total numbers of alleles


Comparisons of genotype frequencies done by applying chi
-
square test


Allele frequencies compared by fisher’s exact test, odds ratios and 95% CI (Confidence
Interval), using statistical software InStat (version 3)


P<0.05 was considered significant.

RESULTS

SIZES OF RESTRICTION PRODUCTS ACCORDING TO
SPECIFIC POLYMORPHISM

Polymorphism

PCR Product Size
(bp)

Restriction
Enzymes

Restriction Product sizes (bp)

D543N

240

Ava II

Allele

1

(A)

(
Asn
)
:

201
,

39

Allele

2

(G)

(Asp)
:

126
,

75
,

39

A318V

232

Fnu4HI

Allele

1

(T)

(Val)
:

232

Allele

2

(C)

(Ala)
:

171
,

61

274 C/T

216

Mnl

I

Allele

1

(T)
:

167
,

37
,

12

Allele

2

(C)
:

102
,

65
,

37
,

12



REPRESENTATIVE GEL OF

PCR
and restriction digestion results for
D543N

Lane 1 = Molecular ladder/marker;

Lane 2 and Lane 11 = undigested PCR product;

Lane 3

10 and 12

19 = Digested samples 1

8 and 9

16 respectively.

PCR RESULTS FOR D543N AFTER RESTRICTION DIGESTION WITH AVA II

Lane 1 = Molecular ladder/marker;

Lane 2 = undigested PCR product;

Lane 3

40 = samples 1

38 respectively.

NUMBER AND PERCENTAGE OF TOTAL SUBJECTS, CONTROLS AND
PATIENTS WITH THEIR GENOTYPING FOR EACH POLYMORPHISM

Polymorphism

Genotype

Total Subjects (181)

Controls (69)

Patients (112)

No.

%

No.

%

No.

%


D543N

G/G

164

90.6

65

94.2

99

88.3

G/A

14

7.7

4

5.8

10

8.9

A/A

3

1.65

-

-

3

2.7


A318V

T/T

-

-

-

-

-

-

T/C

115

63.5

29

42

86

76.8

C/C

66

36.5

40

58

26

23.2


274C/T

T/T

13

7.2

-

-

13

11.6

T/C

42

23.2

22

31.9

20

17.8

C/C

126

69.6

47

68.1

79

70.5

D543N GENOTYPIC PERCENTAGES IN TOTAL SUBJECTS,
PATIENTS AND CONTROLS

A318V GENOTYPIC PERCENTAGES IN TOTAL SUBJECTS,
CONTROLS AND PATIENTS

274C/T GENOTYPIC PERCENTAGES IN TOTAL SUBJECTS,
CONTROLS AND PATIENTS

CHI
-
SQUARE TEST RESULTS

D534N


None of the three genotypes G/G, G/A & A/A showed significant
association with RA


A318V


Genotype C/T showed significant associated with RA (P< 0.001)


274C/T


Significant association of T/T genotype with RA (P< 0.001) observed

NUMBER AND FREQUENCY OF G AND A ALLELES OF D543N

Subjects

Alleles

G

A

No.

Frequency

No.

Frequency

Total

342

0.94

20

0.06

Patients

208

0.93

16

0.07

Controls

134

0.97

4

0.03

NUMBER AND FREQUENCY OF T AND C ALLELES AT A318V

Subjects

Alleles

T

C

No.

Frequency

No.

Frequency

Total

115

0.32

247

0.68

Patients

86

0.38

138

0.62

Controls

29

0.2

109

0.8

NUMBER AND FREQUENCY OF T AND C ALLELES AT 274C/T

Subjects

Allele

T

C

No.

Frequency

No.

Frequency

Total

68

0.2

294

0.8

Patients

46

0.21

178

0.79

Controls

22

0.16

116

0.84

ALLELE CARRIAGE FREQUENCIES IN RA PATIENTS
AND CONTROLS

Polymorphism

Alleles

RA Patients

(n =
112)

Controls

(n = 69)

P

Odds Ratio

(95 % C
I)

D543N

G

208 (57.5%)

134 (37.5 %)

0.1005 (N.S.)

A

16 (4 %)

4 (1 %)

A318V

T

86 (24%)

29 (8 %)

0.0007
*

0.3881

(0.1270


1.186)

C

138 (38 %)

109 (30 %)

274 C/T

T

46 (13 %)

22 (6 %)

0.3325 (N.S.)

C

178 (49%)

116 (32 %)

DISCUSSION

COMPARISON OF ALLELIC FREQUENCIES AT THREE LOCI OF
NRAMP1 IN NORMAL INDIVIDUALS OF DIFFERENT POPULATIONS

Polymorphis
m

Allele

Taiwan

(
n =

96)

Hong
Kong

(
n
= 40)

Caucasian

(
n
= 120)

African


(
n
= 834)

African
American
(
n
= 222)

Columbian
Hispanic
(
n
= 270)

Pakistan
(n = 69)

274C/T

T

0.01

0.12

0.27

Nil

Nil

0.34

0.16

C

0.99

0.88

0.73

Nil

Nil

0.66

0.84

A318V

T

0.00

0.00

0.00

Nil

Nil

Nil

0.2

C

1.00

1.00

1.00

Nil

Nil

Nil

0.8

D543N

A

0.15

0.18

0.01

0.05

0.09

0.05

0.03

G

0.85

0.82

0.99

0.95

0.91

0.95

0.97

CONCLUSION


The genotype C/T and the
allele T of
A318V are highly significantly
associated (P<0.001) with susceptibility to RA in Pakistani population.



Similarly the genotype T/T of 274C/T showed significant association
with the disease and related with susceptibility to RA.



None of the genotypes or alleles of D543N is associated with RA in
Pakistani population.

THANK YOU

Any Questions?