Beef Cattle Production Management Series - Introduction to Biotechnology


12 Δεκ 2012 (πριν από 5 χρόνια και 5 μήνες)

381 εμφανίσεις

Beef Cattle Production
Management Series


Introduction to Biotechnology

Part I


July 31st 2008

Clay Center, NE

Jim Bono, PhD


US Meat Animal Research Center

Clay Center, NE

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering

Molecular Genetics (DNA, RNA, and Proteins)

Part II

Applied Molecular Genetics

DNA extraction


DNA libraries

Polymerase Chain Reaction (PCR)

DNA sequencing

Single Nucleotide Polymorphism (SNP)



is the application of scientific techniques to modify
and improve plants, animals, and microorganisms to enhance
their value.


Agricultural biotechnology

is the area of biotechnology involving
applications to agriculture. Agricultural biotechnology has been
practiced for a long time, as people have sought to improve
agriculturally important organisms by selection and breeding. An
example of traditional agricultural biotechnology is the development
of disease
resistant wheat varieties by cross
breeding different
wheat types until the desired disease resistance was present in a
resulting new variety.

In the 1970s, advances in the field of molecular biology provided
scientists with the ability to readily transfer DNA

the chemical
building blocks that specify the characteristics of living organisms

between more distantly related organisms. Today, this technology
has reached a stage where scientists can take one or more specific
genes from nearly any organism, including plants, animals,
bacteria, or viruses, and introduce those genes into another
organism. This technology is sometimes called
. An organism that has been modified, or transformed,
using modern biotechnology techniques of genetic exchange is
referred to as a
genetically modified organism


Genetic Engineering & GMO

Roundup herbicide resistance

Insect resistance (
Bacillus thuringiensis

Insulin production


(low phosphorus manure



Which bull would be the best sire?

Can you tell by their appearance?

Which bacteria is pathogenic to humans?

Can you tell by their appearance?

“Genetic Playbook”

All living organisms have DNA

Genome = all genetic material in a cell







Deoxyribonucleic acid (DNA)

Deoxyribonucleic acid (DNA)

Nucleotides or bases









Deoxyribonucleic acid (DNA)

Deoxyribonucleic acid (DNA)

Nucleotide or base

Major groove

Minor groove



Double Helix

DNA Replication

Spontaneous mutation

Point mutation



1 error per 1,000 bacterial replication cycles

A gene is a locatable region of genomic sequence,
corresponding to a unit of inheritance, which is associated
with regulatory regions, transcribed regions and/or other
functional sequence regions.

A gene is a union of genomic sequences encoding a
coherent set of potentially overlapping functional

A gene is often used to refer to an inheritable trait which is
usually accompanied by a phenotype as in ("tall genes" or
"bad genes")



“One gene, one Protein”






Gene content of various organisms


Number of genes

Mycoplasma genitalium


Streptococcus pneumoniae


Escherichia coli


Saccharomyces cerevisiae


Drosophila melanogaster


Caenorhabditis elegans


Sea urchin


Arabidopsis thaliana


Homo sapiens


Mus musculus


Oryza sativa
















Model Gene



Coding or

Sense strand


Promoter element


Translational start codon


Translational stop codon


Polyadenylation signal


Transcriptional initiation /termination sites

Typically, cartoon renderings reflect only the single, “sense”

strand, but realize there is always also a complementary strand.

(Exons contain protein coding sequence,
bacterial genes don’t have introns)

Protein Biosynthesis










Making a copy of the gene that can be used for translation

Protect the DNA

Uracil (U) instead of Thymine (T)

RNA polymerase reads the nucleotide sequence of the gene
and makes a single stranded messenger RNA (mRNA)


Process of making a protein from the mRNA

Changing language from nucleotides to amino acids

Ribosome is responsible for reading the mRNA and making the protein

Translational start


Translational stop


3 nucleotides are called a codon

Each codon codes for a specific amino acid

20 amino acids

The Genetic Code





Encoded Amino Acid

The Genetic Code

F.W. Nicholas, 1996, Introduction To
Veterinary Genetics. Oxford Univ.

Transfer RNA (tRNA)





DNA synthesized 5’

Protein synthesized amino


Eukaryotic Protein Biosynthesis







Exon 1

Exon 2




Promoter element


Translational start codon


Translational stop codon


Polyadenylation signal


Exon 1
Exon 2







Translation (@ ribosomes & tRNA)



Transcriptional initiation /termination sites










(In nucleus)

(In cyctoplasm)


Design you own gene

Promoter element

Translational start codon

Translational stop codon

Polyadenylation signal

Transcriptional initiation /termination sites


Double stranded DNA

Met Pro Ile Gly Asn



atattcttctagatcctttcctctctaaa TAC GGA TAA CCA TTG

Asn Val Leu Gly Stop

cttggtcataatccc AAT GTG CTT GGT TAA

gaaccagtattaggg TTA CAC GAA CCA ATT cttctagattat



Homework example



Transcriptional initiation signal


5’ UTR


Translational start




Translational termination


3’ UTR


polyadenylation signal

Beef Cattle Production
Management Series


Introduction to Biotechnology

Part II


July 31st 2008

Clay Center, NE

Jim Bono, PhD


US Meat Animal Research Center

Clay Center, NE

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering

Molecular Genetics (DNA, RNA, and Proteins)

Part II

Applied Molecular Genetics

DNA extraction


DNA libraries

Polymerase Chain Reaction (PCR)

DNA sequencing

Single Nucleotide Polymorphism (SNP)


DNA extraction

Important to have clean DNA for further experiments

“dirty” prep can have contaminates that inhibit enzymatic processes

Agarose gel electrophoresis







Escherichia coli






Escherichia coli









Restriction endonucleases

Enzymes that cuts double
stranded DNA following its specific
recognition of short nucleotide sequences, known as restriction
sites, in the DNA


An enzyme that can link together two DNA strands that have
strand breaks, i.e. DNA cut with a restriction endonuclease.


DNA libraries

Genomic library:

Contains entire DNA content

of an organism

Suitable for determining

genomic DNA sequence

Requires chromosomal DNA


cDNA library:

Contains entire protein

encoding DNA content

Messenger RNA used as a

starting material

Messenger RNA reverse

transcribed into cDNA

Requires mRNA isolation

Polymerase Chain Reaction (PCR)

PCR is now a common and often indispensable
technique used in medical and biological
research labs for a variety of applications.

DNA cloning for sequencing

based phylogeny

functional analysis of genes

diagnosis of hereditary diseases

identification of genetic fingerprints (used in

forensic sciences and paternity testing)

detection and diagnosis of infectious diseases.

In 1989 Science Magazine named Taq
polymerase its first "Molecule of the Year".

Kary Mullis received the Nobel Prize in 1993,
the only one awarded for research performed
at a biotechnology company.

Taq polymerase

Chien A, Edgar DB, Trela JM (1976).
"Deoxyribonucleic acid polymerase from the
extreme thermophile Thermus aquaticus".

174: 1550


DNA sequencing

The process of determining the exact order of the nucleotides/bases
(A, T, C, and G) that make up the DNA of an organism.

Gene number, exact locations, and functions

Gene regulation

DNA sequence organization

Chromosomal structure and organization

Noncoding DNA types, amount, distribution, information content, and functions

Coordination of gene expression, protein synthesis, and post
translational events

Interaction of proteins in complex molecular machines

Predicted vs experimentally determined gene function

Evolutionary conservation among organisms

Protein conservation (structure and function)

Proteomes (total protein content and function) in organisms

Correlation of SNPs (single
base DNA variations among individuals) with health and disease

susceptibility prediction based on gene sequence variation

Genes involved in complex traits and multigene diseases

Complex systems biology including microbial consortia useful for environmental restoration

Developmental genetics, genomics

Roche FLX 454

100 million bases per chip


1 week from DNA extraction to sequence data

E. coli

genome 5.5 million bases

a 454 run will give an 18x coverage

Human genome 3 billion base

30 runs would give a 1X coverage

ABI 3730 (384 well plate)

422 thousand bases per plate

9 plates = $6,000

4 million bases

2 weeks from DNA extraction to sequence data

New Sequencing technologies

Single Nucleotide Polymorphism (SNP)

DNA sequence variation occurring when a single nucleotide

A, T,
C, or G

in the genome (or other shared sequence) differs between
members of a species (or between paired chromosomes in an

Not all SNPs cause a phenotypic change

50K SNP chip

interrogates 50,000 SNP


Association of disease traits


Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, Keele JW, Smith TP, Chitko
McKown CG, Laegreid WW. Selection and use of SNP markers for animal identification and paternity
analysis in U.S. beef cattle. Mamm Genome. 2002 May;13(5):272

Clawson ML, Heaton MP, Chitko
McKown CG, Fox JM, Smith TP, Snelling WM, Keele JW, Laegreid WW.
microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in
newborn calves. Mamm Genome. 2004 Mar;15(3):227








































EDL 931


EDL 933



































SNPs in
E. coli


Ability to predict those
isolates which can cause
disease in humans

B. Finlay

paternal chromosome

maternal chromosome



individual #3:

individual #2:

paternal chromosome

maternal chromosome



Exon 3

Exon 1

Exon 2

Exon 4



paternal chromosome

maternal chromosome



individual #1:


DNA trace












Many different technologies for
SNP interrogation





time PCR

DNA Microarrays

A high
throughput technology that
consists of an arrayed series of
thousands of microscopic spots of DNA
oligonucleotides of a specific DNA
sequence. This can be a short section
of a gene or other DNA element that are
used as probes to hybridize DNA or
cDNA sample (called target) under high
stringency conditions. Probe
hybridization is usually detected and
quantified by fluorescence
detection of fluorophore
labeled targets
to determine relative abundance of
nucleic acid sequences in the target.


is the process of combining complementary, single
stranded nucleic acids into a single molecule.








::::::: :::::::










mRNA expression

Gene content

DNA microarrays


Describe PCR in your own words and pictures

Describe a potential application for SNP genotyping
in veterinary medicine or beef production
