Beef Cattle Production Management Series - Introduction to Biotechnology

butterbeanscubaΒιοτεχνολογία

12 Δεκ 2012 (πριν από 4 χρόνια και 11 μήνες)

369 εμφανίσεις

Beef Cattle Production
Management Series

(2008)


Introduction to Biotechnology


Part I

GPVEC

July 31st 2008

Clay Center, NE

Jim Bono, PhD

Microbiologist

US Meat Animal Research Center

Clay Center, NE

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering


Molecular Genetics (DNA, RNA, and Proteins)



Part II

Applied Molecular Genetics


DNA extraction


Cloning


DNA libraries


Polymerase Chain Reaction (PCR)


DNA sequencing


Single Nucleotide Polymorphism (SNP)


Microarrays


Biotechnology

is the application of scientific techniques to modify
and improve plants, animals, and microorganisms to enhance
their value.

Biotechnology

Agricultural biotechnology

is the area of biotechnology involving
applications to agriculture. Agricultural biotechnology has been
practiced for a long time, as people have sought to improve
agriculturally important organisms by selection and breeding. An
example of traditional agricultural biotechnology is the development
of disease
-
resistant wheat varieties by cross
-
breeding different
wheat types until the desired disease resistance was present in a
resulting new variety.

http://www.ctahr.hawaii.edu/gmo/intro/

In the 1970s, advances in the field of molecular biology provided
scientists with the ability to readily transfer DNA


the chemical
building blocks that specify the characteristics of living organisms
-

between more distantly related organisms. Today, this technology
has reached a stage where scientists can take one or more specific
genes from nearly any organism, including plants, animals,
bacteria, or viruses, and introduce those genes into another
organism. This technology is sometimes called
genetic
engineering
. An organism that has been modified, or transformed,
using modern biotechnology techniques of genetic exchange is
referred to as a
genetically modified organism

(“
GMO
”).

Genetic Engineering & GMO

Roundup herbicide resistance

Insect resistance (
Bacillus thuringiensis
)

Insulin production

Enviropig

(low phosphorus manure
-

phytate
-

phytase)



http://www.ctahr.hawaii.edu/gmo/intro/

Which bull would be the best sire?

Can you tell by their appearance?

Which bacteria is pathogenic to humans?

pathmicro.med.sc.edu

www.biology.iupui.edu

Can you tell by their appearance?

“Genetic Playbook”

www.petecarroll.com

http://www.kursus.kvl.dk/shares/vetgen/_Popgen/ge
netics/10/10/sld003.htm

All living organisms have DNA

Genome = all genetic material in a cell

Chromosomes

Chromosome

Plasmid/s

Genome

Eukaryotes

Prokaryotes

Deoxyribonucleic acid (DNA)

Deoxyribonucleic acid (DNA)

Nucleotides or bases

Adenine
-

A

Cytosine
-

C

Guanine
-

G

Thymine
-

T

Deoxyribonucleic acid (DNA)

http://en.wikipedia.org/wiki/DNA

Deoxyribonucleic acid (DNA)



Nucleotide or base


Major groove


Minor groove


Phosphate
-
deoxyribose

backbone

Double Helix

DNA Replication

Spontaneous mutation


Point mutation


Insertion


Deletion


1 error per 1,000 bacterial replication cycles

A gene is a locatable region of genomic sequence,
corresponding to a unit of inheritance, which is associated
with regulatory regions, transcribed regions and/or other
functional sequence regions.


A gene is a union of genomic sequences encoding a
coherent set of potentially overlapping functional
products".


A gene is often used to refer to an inheritable trait which is
usually accompanied by a phenotype as in ("tall genes" or
"bad genes")

Gene

Historically:

“One gene, one Protein”

eae

cesT

tir

L0028

L0029

Gene content of various organisms

Species

Number of genes

Mycoplasma genitalium

500

Streptococcus pneumoniae

2,300

Escherichia coli

4,400

Saccharomyces cerevisiae

5,800

Drosophila melanogaster

13,700

Caenorhabditis elegans

19,000

Sea urchin

23,300

Arabidopsis thaliana

25,500

Homo sapiens

27,000

Mus musculus

29,000

Oryza sativa

50,000

ATG

TAA

AATAA

TATA (
-
30)

I

5’
-
UT

E

E

3’
-
UT

Promoter

*

*

5’

3’

Model Gene

EXONS

INTRON

Coding or

Sense strand

TATA
-

Promoter element

ATG
-

Translational start codon

TGA, TAA, TAG
-

Translational stop codon

AATAA
-

Polyadenylation signal

*
-

Transcriptional initiation /termination sites

Typically, cartoon renderings reflect only the single, “sense”

strand, but realize there is always also a complementary strand.

(Exons contain protein coding sequence,
bacterial genes don’t have introns)

Protein Biosynthesis

GGATCGGCTAGCTG……...CTACATAGCTAT

GGAUCGGCUAAGCUAU

Gly
-
Ser
-
AlA
-
…………..

Gene

mRNA

Protein

Transcription

Translation

Transcription

Making a copy of the gene that can be used for translation


Protect the DNA


Uracil (U) instead of Thymine (T)


RNA polymerase reads the nucleotide sequence of the gene
and makes a single stranded messenger RNA (mRNA)

http://www.dnai.org/a/index.html

Translation

Process of making a protein from the mRNA


Changing language from nucleotides to amino acids


Ribosome is responsible for reading the mRNA and making the protein


Translational start


ATG


Translational stop


TAA, TGA, TAG


3 nucleotides are called a codon


Each codon codes for a specific amino acid


20 amino acids



http://www.dnai.org/a/index.html

The Genetic Code


DNA

Codon

mRNA

Codon

Encoded Amino Acid

The Genetic Code

F.W. Nicholas, 1996, Introduction To
Veterinary Genetics. Oxford Univ.
Press

Transfer RNA (tRNA)

Anti
-
codon

Protein

Amino(N)
-
terminus

Carboxyl(C)
-
terminus

DNA synthesized 5’
-
3’

Protein synthesized amino
-

carboxyl

Eukaryotic Protein Biosynthesis

ATG

TAA

AATAA

TATA (
-
30)

Intron

5’
-
UT

Exon 1

Exon 2

3’
-
UT

Promoter

TATA
-

Promoter element

ATG
-

Translational start codon

TAA, TGA, TAG
-

Translational stop codon

AATAA
-

Polyadenylation signal

5’
-
UT

Exon 1
---
Exon 2

3’
-
UT

mRNA

Gene

Transcription

AAAA

Pre
-
Protein

Translation (@ ribosomes & tRNA)

*

*
-

Transcriptional initiation /termination sites

*

*

*

5’

3’

5’

3’

N
-
terminus

C
-
terminus

(In nucleus)

(In cyctoplasm)

Homework

Design you own gene

Promoter element

Translational start codon

Translational stop codon

Polyadenylation signal

Transcriptional initiation /termination sites

Intron

Double stranded DNA


Met Pro Ile Gly Asn

tataa
gaagatc
taggaaaggagagattt

ATG CCT ATT GGT AAC

atattcttctagatcctttcctctctaaa TAC GGA TAA CCA TTG



Asn Val Leu Gly Stop

cttggtcataatccc AAT GTG CTT GGT TAA
gaagatct
aata

gaaccagtattaggg TTA CAC GAA CCA ATT cttctagattat



a
gggatgcatccc

tccctacgtaggg

Homework example

Legend

tataa


Transcriptional initiation signal

taggaaaggagagattt


5’ UTR

ATG


Translational start

cttggtcataatccc


intron

TAA


Translational termination

gaagatct


3’ UTR

aataa


polyadenylation signal

Beef Cattle Production
Management Series

(2008)


Introduction to Biotechnology


Part II

GPVEC

July 31st 2008

Clay Center, NE

Jim Bono, PhD

Microbiologist

US Meat Animal Research Center

Clay Center, NE

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering


Molecular Genetics (DNA, RNA, and Proteins)



Part II

Applied Molecular Genetics


DNA extraction


Cloning


DNA libraries


Polymerase Chain Reaction (PCR)


DNA sequencing


Single Nucleotide Polymorphism (SNP)


Microarrays


DNA extraction

Important to have clean DNA for further experiments


“dirty” prep can have contaminates that inhibit enzymatic processes

Agarose gel electrophoresis

http://www.accessexcellence.org/RC/VL/GG/plasmid.php

http://student.britannica.com/comptons/ar
t
-
90884/DNA
-
sequences
-
can
-
be
-
cut
-
in
-
two
-
ways?&articleTypeId=31

Cloning

Enzyme

Source

Recognition
Sequence

Cut

Eco
RI

Escherichia coli

5'GAATTC

3'CTTAAG

5'
---
G AATTC
---
3'

3'
---
CTTAA G
---
5'

Eco
RV*

Escherichia coli

5'GATATC
3'CTATAG

5'
---
GAT ATC
---
3'
3'
---
CTA TAG
---
5'

Bam
HI

Bacillus
amyloliquefaciens

5'GGATCC

3'CCTAGG

5'
---
G GATCC
---
3'

3'
---
CCTAG G
---
5'

Restriction endonucleases

Enzymes that cuts double
-
stranded DNA following its specific
recognition of short nucleotide sequences, known as restriction
sites, in the DNA

Ligase

An enzyme that can link together two DNA strands that have
single
-
strand breaks, i.e. DNA cut with a restriction endonuclease.

http://www.accessexcellence.org/RC/VL/GG/plasmid.php

http://student.britannica.com/comptons/ar
t
-
90884/DNA
-
sequences
-
can
-
be
-
cut
-
in
-
two
-
ways?&articleTypeId=31

Cloning

DNA libraries

Genomic library:


Contains entire DNA content


of an organism




Suitable for determining


genomic DNA sequence





Requires chromosomal DNA


isolation

cDNA library:

Contains entire protein
-


encoding DNA content




Messenger RNA used as a


starting material




Messenger RNA reverse


transcribed into cDNA




Requires mRNA isolation

Polymerase Chain Reaction (PCR)

www.mun.ca/biology/scarr/PCR_sketch_3.gif

PCR is now a common and often indispensable
technique used in medical and biological
research labs for a variety of applications.









DNA cloning for sequencing

DNA
-
based phylogeny

functional analysis of genes

diagnosis of hereditary diseases

identification of genetic fingerprints (used in


forensic sciences and paternity testing)

detection and diagnosis of infectious diseases.

In 1989 Science Magazine named Taq
polymerase its first "Molecule of the Year".


Kary Mullis received the Nobel Prize in 1993,
the only one awarded for research performed
at a biotechnology company.

Taq polymerase

Chien A, Edgar DB, Trela JM (1976).
"Deoxyribonucleic acid polymerase from the
extreme thermophile Thermus aquaticus".
J.
Bact.

174: 1550

1557

http://www.yellowstone.net/geysers/thermalfeatures.htm

en.wikipedia.org

DNA sequencing

The process of determining the exact order of the nucleotides/bases
(A, T, C, and G) that make up the DNA of an organism.


Gene number, exact locations, and functions

Gene regulation

DNA sequence organization

Chromosomal structure and organization

Noncoding DNA types, amount, distribution, information content, and functions

Coordination of gene expression, protein synthesis, and post
-
translational events

Interaction of proteins in complex molecular machines

Predicted vs experimentally determined gene function

Evolutionary conservation among organisms

Protein conservation (structure and function)

Proteomes (total protein content and function) in organisms

Correlation of SNPs (single
-
base DNA variations among individuals) with health and disease

Disease
-
susceptibility prediction based on gene sequence variation

Genes involved in complex traits and multigene diseases

Complex systems biology including microbial consortia useful for environmental restoration

Developmental genetics, genomics


Roche FLX 454

100 million bases per chip

$6,000

1 week from DNA extraction to sequence data

E. coli

genome 5.5 million bases


a 454 run will give an 18x coverage

Human genome 3 billion base


30 runs would give a 1X coverage



ABI 3730 (384 well plate)

422 thousand bases per plate

9 plates = $6,000

4 million bases

2 weeks from DNA extraction to sequence data


New Sequencing technologies

Single Nucleotide Polymorphism (SNP)

DNA sequence variation occurring when a single nucleotide
-

A, T,
C, or G
-

in the genome (or other shared sequence) differs between
members of a species (or between paired chromosomes in an
individual).

Not all SNPs cause a phenotypic change

50K SNP chip


interrogates 50,000 SNP


Parentage




Association of disease traits

FPT

Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, Keele JW, Smith TP, Chitko
-
McKown CG, Laegreid WW. Selection and use of SNP markers for animal identification and paternity
analysis in U.S. beef cattle. Mamm Genome. 2002 May;13(5):272
-
81.

Clawson ML, Heaton MP, Chitko
-
McKown CG, Fox JM, Smith TP, Snelling WM, Keele JW, Laegreid WW.
Beta
-
2
-
microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in
newborn calves. Mamm Genome. 2004 Mar;15(3):227
-
36.

0

5

10

15

20

25

30

35

100

0

0

100

91

89

87

100

0

0

0

0

0

0

0

0

0

100

97

94

95

78

KS368

KS546

TX265

TX723

NE972

NE1370

CO50

TX376

Mass2

EDL 931

1271
-
84

EDL 933

CO147

CO713

IDPH31277

MARC611

NE1124

TW04863

WRRC1

NE1270

Sakai

TW05356

3526
-
87

bovine

bovine

bovine

bovine

bovine

bovine

bovine

bovine

human

human

human

human

bovine

bovine

human

bovine

bovine

bovine

human

bovine

human

bovine

human

SNPs in
E. coli

O157:H7

Ability to predict those
isolates which can cause
disease in humans

B. Finlay

paternal chromosome

maternal chromosome

…aatggtatc
T
attaatgctt…

…aatggtatc
T
attaatgctt…

individual #3:

individual #2:

paternal chromosome

maternal chromosome

…aatggtatc
A
attaatgctt…

…aatggtatc
A
attaatgctt…

Exon 3

Exon 1

Exon 2

Exon 4

gene

SNP

paternal chromosome

maternal chromosome

…aatggtatc
A
attaatgctt…

…aatggtatc
T
attaatgctt…

individual #1:

T/T

DNA trace
files

A/A

A/T

T/T

5100

5400

5700

A/A

MALDI
-
TOF
spectra

A

T

SNPs

Many different technologies for
SNP interrogation

Biotrove

Affymetrix

Illuminia

Sequenome

Real
-
time PCR

DNA Microarrays

A high
-
throughput technology that
consists of an arrayed series of
thousands of microscopic spots of DNA
oligonucleotides of a specific DNA
sequence. This can be a short section
of a gene or other DNA element that are
used as probes to hybridize DNA or
cDNA sample (called target) under high
-
stringency conditions. Probe
-
target
hybridization is usually detected and
quantified by fluorescence
-
based
detection of fluorophore
-
labeled targets
to determine relative abundance of
nucleic acid sequences in the target.

Hybridization

is the process of combining complementary, single
-
stranded nucleic acids into a single molecule.

Hybridization

...ATGCATGCATGCATGC...

...TACGTACGTACGTACG*..


::::::::::::::::

Perfect
-

...ATGCATGGGTGCATGC...

...TACGTACGTACGTACG*..


::::::: :::::::

Imperfect
-

...ATGCATG TGCATGC...

...TACGTACGTACGTACG*..


:::::::

Imperfect
-

G G

T T

G


:::::::

mRNA expression
SNPs

Gene content

DNA microarrays

http://www.bio.davidson.edu/Co
urses/genomics/chip/chip.html

Homework

Describe PCR in your own words and pictures

Describe a potential application for SNP genotyping
in veterinary medicine or beef production

http://www.blackwellpublishing.com/trun/artwork/
Animations/cloningexp/cloningexp.html

http://www.dnai.org/

http://dynamicgene.dnalc.org/structure/structure.html

Websites