Study Guide Molecular Genetics – Bio K

bewilderedvoyageΒιοτεχνολογία

12 Δεκ 2012 (πριν από 4 χρόνια και 11 μήνες)

287 εμφανίσεις

Bio K


Molecular Biology


Study Guide Molecular Genetics


Bio K


General information:


Some important molecules are made by linking together small molecules into large chains. The individual
molecules are called __
monomers
_____ while the chains are called __
polymers
_______________.


The chemical reaction that links these molecules together is called _
dehydration synthesis
__

while the chemical
reaction that breaks them apart is called

hydrolysis
___.


Enzymes are proteins that _
speed up chemical reactions in the cel
l making them easier
________.



DNA Structure:


Chromosomes were initially identified as the part of the cell responsible for giving us our traits.


-

Chromosomes are made of __
DNA
_____________ and _
Protein
_____


-

Other experiments showed that it is the
____
DNA
_________ in the chromosomes that is


our genetic material not the __
protein
____________________.



The scientists __
Watson
_____ and __
Crick
______ discovered the shape of the DNA molecule and described it


as a ___
double helix
_______.


-

This me
ans that the DNA looks like a __
spiral staircase
__________.


DNA two long chains of ____
nucleotides
_________ twisted together.


A single DNA nucleotide is made of the following three parts:

-

A sugar called __
deoxyribose
______________________________


-

A n
itrogen base that can be _
adenine, thymine, guanine, cytosine
____


-

A phosphate

Draw a picture of a Nucleotide for DNA below:
see text book for picture








The two chains of DNA must be _
complementary
________ to each other meaning:

All Adenines pair
with ___
thymines
___________________


All Guanines pair with __
cytosines
____________________

Bio K


Molecular Biology



There are no Uracil’s in DNA!!!

Replication:


DNA lives in the ___
nucleus
________________________ so it must be copied there


What is replication? When does it happen?

-

Process by which we copy the DNA

-

Happens before cells divide



Describe the
steps

of replication

including the enzymes used


1.


Untwist the two strands of DNA using the enzyme helicase

2.

Build the complementary chain
of DNA on each original chain using DNA polymerase



RNA structure:


RNA is a single chain of __
nucleotides
________________________________________


A single RNA nucleotide is made of the following three parts:

-

A sugar called __
ribose
_____________________________


-

A nitrogen base that can be __
adenine, cytosine, guanine or uracil
_______


-

A phosphate


There are three types of RNA.
Describe the role e
ach one plays in making protein.

-

mRNA:
has the instructions for how to make the prote
in



-

tRNA:
carries the correct amino acids to the ribosome to use to build the protein



-

rRNA:
is part of the ribosome



In the mRNA, every group of ___
3
_________ nucleotides is called a ____
codon
___________________.


-

AUG is the __
start codon
____ and is
where _
the ribosome starts reading the directions. It will also set up
the reading frame.
______


-

UAG, UAA and UGA are the _
stop codons
__ and are where __
the ribosome stops linking amino acids to
the polypeptitde
________





Bio K


Molecular Biology



Making Protein:
Transcription and Translation


To make the three types of RNA we have to go through __
transcription
_ which reads the DNA and builds RNA


-

Transcribe the following piece of DNA into RNA:


DNA:

CTGGTACGGCCTCATATCAATCCAT


mRNA:
GACC
AUG

CCG GAG UAU

AG
U
UAG

GUA



Since the DNA needs to be read to build the RNA , transcription must take place in the __
NUCLEUS
__
__.


BUT we only need to build RNA one “recipe” at a time. The scientific word for a single recipe in the DNA is
___
g
ene
__________________.


These “recipes” teach the cell how to make ___
proteins
______________________.



Once the mRNA is made it will move to the __
ribosomes
____ so its directions can be read and followed.


The ribosome will read the mRNA one _
codon
__
__ at a time beginning with the start codon. Circle the start
codon in the mRNA you transcribed above.
In italics


The ribosome will bring in tRNA molecules with complementary __
anticodons
_____ on one end and
an


_
amino acid
____ on the other end until it

reaches a stop codon. Put a box around the stop codon above.
In
bold



The __
genetic code
__ is the “translation dictionary” that tells the ribosome what amino acid each codon means.


Draw the sequence of tRNA molecules that will be brought in to your
piece of mRNA shown above. Be sure to
show both th
e anticodon and amino acid. YES this means you need your chart. Remember we look up the
CODON not the ANTICODON




Amino acids:

Met

Pro Glu Tyr Ser STOP

Anticodons:

UAC
GGC

CUC

AUA


UCA

AUC





Proteins are made by linking together __
amino acids
_____ during a process called



__
translation
______. This occurs at the _
ribosome
____________________________ of the cell.



Bio K


Molecular Biology


Mutations:


What is a mutation?

-

A permanent change in the
DNA that can be good, bad or have no effect



__
mutagens
____ are environmental things that cause mutations. They include:



_
UV light, radiation, chemicals
_______________________________.



Mutations also occur when _
DNA polymerase
______ makes a mistake d
uring DNA replication.


__
Point
___mutations affect a single nucleotide.


Describe each of the following:


Substitutions __
one nucleotide is swapped with another


GAC becomes GAA


Insertions: __
one nucleotide is added, causes a frame shift;
-

GAC bec
omes GAT C


Deletions:
__one nucleotide is removed, causes a frame shift;
-

GAC becomes GC


Frameshifts: __
groups of three nucleotides are changed


THE CAT ATE becomes HEC ATA TE


Nonsense:

a stop codon is created earlier; UAC


UAG


Silent:
A codon

is changed, but the amino acid stays the same


GGG becomes GGC but both code for Glycine


Genetic Engineering

and testing
:



What is genetic engineering
?

-

Changing the DNA of an organism through laboratory techniques


What is cloning? How do we do it? Wh
at is the important molecule?

-

Creating an organism identical to its ONLY parent; Must move ALL the DNA from parent into the baby.
No mixing of DNA from two parents

-

Take DNA from the body cell of parent

-

Remove nucleus from egg cell

-

Inject nucleus from bod
y cell into empty egg cell

-

Grow baby



What is a transgenic organism?

Give three examples that help us in terms of
either food or medicine
.
(glow in the dark mice do not
count)

-

An organism with a gene that came from another organism

-

Examples: plants with i
nsecticide genes, cows with growth hormone, insulin making bacteria



Bio K


Molecular Biology


Briefly, how are transgenics made?

-

Find the gene you are interested in, cut it out of the nucleus, inject it into the nucleus of the organism you
WANT to have the gene.

-

New organism wi
ll read the gene and make the protein

-

Protein gives new organism new trait



What is genetic testing
?

Is this a type of genetic engineering?


-

Examining cells for gene mutations, chromosomal mutations or abnormal protein levels. No it is not
genetic engineering because the DNA is not being changed.


What is a DNA fingerprint?

-

A gel displaying fragments of DNA sorted by size



What are they use
d for?

-

To compare DNA from two samples

-


Paternity cases

-

Crime scenes

-

Evolutionary relationships


How is one done?

1.


Cut each sample with restriction enzyme

2.

Inject each sample into gel block

3.

Perform electrophoresis (small pieces travel further than long pi
eces)

4.

Compare bands and look for bands (fragments) that are the same size.



BE ABLE TO READ A DNA FINGER PRINT!!!!




Vocabulary:

Nucleotide

Amino Acid


rRNA


mutation

Translation

Helix

Transcription

Transgenic


Ribosome

chromosome

tRNA


Restriction
enzyme

Replication

Amniocentesis


Nucleus

codon


mRNA


Electrophoresis

Mutation

Mutagen