2011 International Symposium & Annual Meeting I_Food ...

mumpsimuskneesBiotechnology

Feb 12, 2013 (1 year and 8 months ago)

457 views

371
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
I
_ Food Microbiology and Biotechnology
Cloning and Characterization of the Purified Cinnamoyl Esterase
from Lactobacillus helveticus KCCM 11223
Young-Ran SONG and Sang-Ho BAIK*
Department of Food Science and Human Nutrition, and Research Institute o
f

Human Ecology, Chonbuk National University, Jeonju, Jeonbuk 561-756, Korea.
*Corresponding author: baiksh@chonbuk.ac.kr
Hydroxycinnamic acids are esterified abundantly to the plant cell walls.
Especially, chlorogenic acid from diet can be hydrolyzed into caffeic acid
by cinnamoyl esterase (CE) for more efficient absorption in human
intestine in order to contribute for human to beneficial effects such as
antioxidant activity. Previously, Lactobacillus helveticus KCCM 11223
was found in our lab to show relatively high activity of CE. In this work,
we obtained the gene encoding a CE by PCR method. The open reading
frame (ORF) of the CE gene was composed of 726 nucleotides and
encoded a protein (242 amino acids). The deduced amino acid sequence
of CE showed 99% and 70% identities to the putative esterase from
L
.
helveticus DSM 20075 and cinnamoyl esterase from L. jonnosonii,
respectively. When this gene was subcloned into pET expression vector
and expressed in E. coli BL21(DE3) (pCE28N-His), most highest level
expression of the CE was obtained with 1.0mM IPTG at 22
o
C for 16
hr. The expressed CE was purified as a single band through 4 steps using
ammonium sulfate, DEAE sepharose anion-exchange, sephadex G-200
gel-filtration and UNO Q1 anion-exchange chromatography. Affinity
chromatography by using his-tag which attached N-terminal area did not
work efficiently to purify the CE by one step purification.
Keywords: Cinnamoyl esterase, , Cloning, Purification
I-1
Isolation and Antimicrobial Effect of Extract of Rhus javanica
on MRSA
A-Ra KIM
1,2
, Do-Kyun KIM
1,2
, Eun-Ji JO
1
, Kyoung-Hoon KIM
1
,
Mi-Nan LEE
1
, Jong Hwa YUM
3
, Byung-Woo KIM
1,2
, Tae-Hoon KIM
4
and
Eun-Woo LEE*
1,2
1
Dept. of Life Science and Biotechnology, Dongeui University, Busan 614-714,
Korea.
2
Blue Bio Industry RIC, Dongeui University, Busan 614-714, Korea.
3
D
ept.
of Clinical Laboratory Science, Dongeui University, Busan 614-714,
K
orea.
4
Dept. of Herbal Medicinal Pharmacology, Daegu Haany University, Gyeongsan
712-715, Korea.
*Corresponding author: ewlee@deu.ac.kr
Methicillin-resistant Staphylococcus aureus (MRSA), bacteria found in
normal daily life, can be easily ingested through milk, vegetables, and
meats etc. MRSA emerged in many part of the world, increasing complex
clinical problems. Therefore, new agents are needed to treat MRSA.
R
hus
j
avanica was extracted using 80% methanol to investigate its antimicrobial
activity against MRSA. Methanol extract of Rhus javanica significantly
inhibited MRSA and thus could be used in development of antibacterial.
Also, the methanol extract was further fractionated with hexane, ethyl
acetate and butanol. The ethyl acetate-soluble fractions show the strongest
antimicrobial activity. The inhibition zones of the Rhus javanica ethyl
acetate extract (60 ug/disc) against MRSA were 18 mm. These fractions
were further separated by using several chromatographic methods
including Diaion HP-20, Toyopearl HW-40C, ODS AQ open column
chromatography and prep. HPLC. A major component RJ-1 and RJ-2 from
the ethyl acetate fraction, which showed a strong antimicrobial activity
was identified by Mass and NMR spectrometry. These results suggested
that these compounds have a strong potential as a natural new drugs.
Keywords: MRSA, Rhus javanica, Antibiotics
I-2
Comparative Genomic Analysis of Salmonella
Typhimurium-Targeting Bacteriophage SPN9CC
Hakdong SHIN
1
, Ju-Hoon LEE
2
and Sangryeol RYU*
1
1
Laboratory of Molecular Food Microbiology, Department of Food and
A
nimal
Biotechnology, Department of Agricultural Biotechnology and Center
f
or
Agricultural Biomaterials, Seoul National University, Seoul 151-921,
K
orea.
2
Laboratory of Food Microbiology and Functional Genomics, Department o
f

Food Science and Biotechnology, CHA University, Seongnam 463-836, Korea.
*Corresponding author: shd@hanmail.net
Salmonella-targeting bacteriophage P22 has been well studied in genomic
level and widely used for transduction. For comparative genomic analysis o
f

P22 phage, a new P22-like lambdoid phage SPN9CC was isolated from an
environmental sample and its complete genome sequence was determined using
454 pyrosequencing. SPN9CC has 40,128 bp double-stranded genomic DNA
encoding 62 putative open reading frames and two tRNAs. Interestingly,
comparative analysis of the ORFs between those phages showed significant
homologies in putative functions of 43 ORFs, suggesting that these
p
hage
genomes are highly conserved in functions. Further phylogenetic analysis o
f

SPN9CC phage with other known phages showed that it is closely related
to a branch of P22-like lambdoid phages, supporting this. As high similarity
between these two phage genomes, the functional gene clusters in SPN9CC
phage genome are also organized like P22 phage genome. While most of
functional gene clusters are highly conserved between these phage genomes,
lysogeny control gene cluster in SPN9CC genome differs from that of P22
phage. Furthermore, lysis gene cluster encoding a endopeptidase and lysozyme
shows only weak homology in protein sequence level, not in DNA level,
suggesting that they probably have different lytic activity.
Keywords: Salmonella Typhimurium, Bacteriophage, P22-like phage
I-3
Isolation and Characterization of Anticariogenic Lactobacillus
sakei from Kimchi
JinSeok MOON, Ji Eun AHN, A Reum HAN, Hyun-Ju EOM and
Nam Soo HAN*
Department of Food Science and Technology, Research Center for Bio Resource
and Health, Chungbuk National University, Cheongju 361-763, Korea.
*Corresponding author: jsmoon@cbnu.ac.kr
The occurrence of dental caries is mainly associated with oral pathogens,
especially cariogenic Streptococcus mutans. The aim of this study was
to isolate and characterize lactic acid bacterium showing inhibitory activity
against S.mutans. As results, an isolate with strong inhibitory activity was
obtained from kimchi and it was identified as Lactobacillus sakei by API
and 16S rRNA gene analyses. This strain secreted an inhibitory compound
in cell growth medium and the activity of the compound was completely
disappeared by proteinase K revealing the compound is proteinous
substance, bacteriocin. Optimal culture condition for bateriocin production
by L.sakei was at pH 7.5 and 37

for 18h. Oral administration of this
isolate may give anticariogenic and probiotic effects on hosts.
Keywords: Streptococcus mutans, Lactobacillus sakei, bacteriocin
I-4
372
www.kormb.or.k
r

Probiotic Properties of Weissella Strains Isolated from Human
Faeces
Kangwook LEE
2
, Ji Yeong PARK
2
, Hee Rok JEONG
2
, Ho-Jin HER
1
,
Nam Soo HAN
3
and Jeong Hwan KIM*
1
1
Insitute of Agriculture &Life Science, Gyeongsang National University,
J
inju
660-701,Korea.
2
Division of Applied Life Science (BK21), Graduate School,
Insitute of Agriculture &Life Science, Gyeongsang National University,
J
inju
660-701,Korea.
3
Dept, Food Sci and Technol, Chungbuk Nat'l University,
Cheongju, Korea.
*Corresponding author: jeonghkm@gsnu.ac.kr
Weissella is a genus belong to lactic acid bacteria (LAB). We report
various probiotic properties of 8 Weissella strains isolated from human
faeces. These Weissella strains were characterized in vitro for their pH
and bile tolerance, adhesion capacity and growth conditions such as
temperatures, NaCl concentrations. Most of Weissella strains were able
to resist pH 3 for 3 h and survival ratio of 4 Weissella strains were high
(survival ratio = 12.25 %, 9.87 %, 20.55 % and 17.34 %). And All strains
were torelant to 0.3% bile salts for 2 h, W.confusa 31 could survive in
MRS broth with 0.3% bile salts, and the survival ratio was highest (survival
ratio = 128.8 %). Adhesion property of strains was determined in vitro
using the human colon cell line Caco2. All Weissella strains possessed
very high adhesion capacity (19.4-86 cfu/cell) compared to the highly
adhesive Lactobacillus rhamnosus GG (12.36 cfu/cell). Weissella strains
also showed relatively good growth at various temperatures (15, 37 and
45

) and NaCl concentrations (6.5 and 8 %). The results presented here
show that Weissella strains are potential strains for probiotics. This work
was supported by National Research Foundation of Korea grant funded
by MEST. K.W.Lee, J.Y.Park and H.R.Jeong were supported by BK21
program
Keywords: weissella, probiotic
I-5
Improvement of Virulence of Entomopathogenic fungus
Lecanicillium sp. L43 towards Aphids
Van Hanh VU*
1
, Thi Thuy Duong LE
2
, Huu Quan NGUYEN
2
,
Xuan Dat VU
2
, Dinh Thi QUYEN
2
and Keun KIM
3
1
Institute of Biotechnology, Vietnam Academy of Science and Technology,18
Hoang Quoc Viet, Caugiay, Hanoi 10600, Vietnam/ Department of Bioscience
and Biotechnology,The University of Suwon, Hwaseong-si 445-743,
K
orea.
2
Institute of Biotechnology, Vietnam Academy of Science and Technology,18
Hoang Quoc Viet, Caugiay, Hanoi 10600, Vietnam.
3
Department of Bioscience
and Biotechnology, The University of Suwon, Hwaseong-si 445-743, Korea.
*Corresponding author: vvhanh@ibt.ac.vn
One fungal isolate L43 producing a very high virulence towards the aphid
Myzus persicae and causing 100% of mortality with LT
50
of 3.0 days was
selected from 27 tested fungal isolates. The fungal isolate L43 was identified
as Lecanicillium sp. based on the sequence of internal transcribed spacer region
of its 28S rDNA and was designated as Lecanicillium sp. L43. L43’s
p
rotoblasts
created by cell wall hydrolyzing enzymes were further improved for higher
virulence production by exposing to irradiation of ultraviolet (UV) while L43’s
blastospores were improved by exposing to N-methyl-N'-nitrosoguanidine
(NTG). At 19~28°C and relative humidity of 70~85%, many UV mutated
colonies were examined for the virulence towards M. persicae using detached
leaves of chinese cabbage, one mutant UV60-3 exhibited the highest mortality
of 100% with LT
50
of 2.2 days, after 4 days treatment. Besides, another
NTG60-4 produced 100% of mortality with LT
50
of 2.6 days was selected
from many NTG mutated colonies. As a result, 4 days after treatment, UV60-3
and NTG60-4 exhibited an increased mortality of 12 and 20%, respectively,
in comparison to the wild type strain. It indicated that usage of both mutation
methods showed an improvement of fungal virulence towards aphids.
Keywords: Entomopathogenic fungus Lecanicillium sp., Mutation, Myzus
persicae
I-6
Antibacterial and Antiviral Activity of Ginseng (Panax ginseng
C.A.Meyer) Leaf Extract
Ah-Reum KIM
1
, Jung-Ran KIM
2
, HeeRok JEONG
2
and Myung-Suk LEE*
1
1
Department of Microbiology, Pukyong National University, Busan 608-737,
Korea.
2
NGETECH Inc. 1545-1, Songjeong-dong, Gangseo-gu, Busan, 618-818,
Korea.
*Corresponding author: cjar3020@naver.com
Panax ginseng C.A. Meyer is a medical plant that has been widely
utilized as a toinc and nutritional agent since ancient times in Korea.
Several pharmacologically activity of ginsenosides have been found in
the root of panax ginseng. However, the root of panax ginseng is valuable
because it takes 4~6 years for growing from the seed, whereas the lea
f

of panax ginseng can be harvested every year. Ginseng leaf has ginsenoside
four to five times than ginseng root which is similar to ginsenoside o
f

ginseng root. This study was investigated the application possibility o
f

methanolic extract from panax ginseng leaf by antibacterial and antiviral
activity. Ginseng leaf extract was performed antibacterial activity by paper
disc method and antiviral activity by 50% tissue culture infectious
dose(TCID50). Paper disc method was observed that inhibition clear zone
of 18.5mm, 22 mm against E. coli and S. aureus in ginseng leaf extract,
respectively. Ginseng leaf extract showed the strongest antiviral activities
against Feline calicivirus(FCV) as a surrogate for norovirus. Interestedly,
5

/

of extract for 6 hr and 1.25

/

of extract for 12 hr, FCV
was completely inactivated. There results suggest that panax ginseng lea
f

extract are a useful resources.
Keywords: Panax ginseng leaf, Antibacterial activity, Antiviral activity
I-7
The Changes after Storage of Pilot-scale Glutinous Rice Wine
using Wild Type Yeast Y89-5-3, Y183-2 isolated from Nuruk
Hye Ryun KIM, Jeoung Mae SON, Jae Ho KIM and Byung Hak AHN*
Korean Alcoholic Beverage Research Center, Korea Food Research Institute,
Gyeonggi-do 463-746, Korea.
*Corresponding author: hrkim@kfri.re.kr
This study was conducted to investigate the changes of physico-chemical
properties and volatile components after storage of pilot-scale glutinous
rice wine using wild type yeast Y89-5-3 (Saccharomyces cerevisiae),
Y183-2 (Saccharomyces cerevisiae) isolated from nuruk . After the first
filtration and disinfection and the second filtration, those were
b
ottled
and the change after storage at 25

for 3 months were determined.
After storage, we analyzed the alcohol content, pH, soluble solid, total
acid, UV absorbance, color degree, organic acid, free sugar and volatile
components. The alcohol contents and the pH levels showed a decline
while the soluble solids, UV absorbance, color degree showed up to
increase. In glutinous rice wine using Y89-5-3, the total acid, glucose,
maltose, acetic and succinic acid were increased whereas fructose, malic,
lactic and citric acid were decreased. In glutinous rice wine using Y183-2,
free sugar and organic acid contents were grown, compared the initial
stage with the final. Volatile flavor components in the glutinous rice wines
were identified by using GC/MSD. After storage for 3 months, the relative
peak area of ethyl caprylate, ethyl caprate and ethyl laurate showed up
to increase in glutinous rice wine using Y183-2.
Keywords: storage, glutinous rice wine, yeast
I-8
373
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Identification and Characterization of Flagellum-dependent
Salmonella Phage iEPS5
Younho CHOI and Sangryeol RYU*
Laboratory of Molecular Food Microbiology, Department of Food and
A
nimal
Biotechnology, Department of Agricultural Biotechnology and Center
f
or
Agricultural Biomaterials, Seoul National University, Seoul 151-921, Korea.
*Corresponding author: younoss1@snu.ac.kr
The choice of host by bacteriophages was considered to be specific
event during life cycles. Phage encounters its bacterial host during random
motion and attaches via specific receptor sites that may be any one of
a wide variety of cell surface molecules. To identify receptor of iEPS5
phage, we constructed random mutant libraries and screened resistant
mutants by dotting assay. All five phage-resistant mutants isolated were
amotile and non-flagellated. To assess the relationship between motility
and phage infection, a mutant deleted for motA was constructed and it
was tested to be resistant to iEPS5. Along with ΔmotA, chemotaxis gene
mutants (ΔcheY, SJW2811 and SJW3076) were checked for their
sensitivity to iEPS5. Interestingly, counterclockwise (CCW)-biased
mutants were sensitive to iEPS5 but clockwise (CW)-biased mutants were
resistant, implying that the CCW rotation of flagella is essential for the
infection of Salmonella by iEPS5. Moreover, the direction of flagellar
rotation was related to the binding of iEPS5 to its receptor flagellar
filament: iEPS5 only adsorbed to CCW rotating flagella. By challenge
assay using polyhook strain, we also found that flagellar filament could
be a site for DNA injection, suggesting a new infection mechanism o
f

flagellatropic bacteriophage.
Keywords: bacteriophage, receptor, flagella
I-9
Characterization of pJY33, a Small Cryptic Plasmid Isolated from
Weissella confusa 33
Ji Yeong PARK
1
, Ji Yeong PARK
1
, Kang Wook LEE
1
, Nam Soo HAN
3
,
Jeong Hwan KIM
1,2
and Jeong Hwan KIM*
1,2
1
Division of Applied Life Science (BK21 program), Graduate School, Gyeongsang
National University, Jinju 660-701, Korea.
2
Research Institute of Life Sciences,
Gyeongsang National University, Jinju 660-701, Korea.
3
Biomaterials.Department
of Food Science and Technology, Chungbuk National University, Cheongju,
361-763, Korea.
*Corresponding author: jeonghkm@gnu.ac.kr
A 2365 bp cryptic plasmid, pJY33, was isolated from Weissella confusa
33, an isolate from human faces. Nucleotide sequence analysis revealed
two open reading frame, orf1 and orf2. orf2 was 849 bp in size and its
translation product had 87 % identity with a hypothetical protein possibly
involved in the replication of pKLCA_p1, a cryptic plasmid from Weissella
cibiria. pJY33 was used for the construction of Escherichia coli-Weissella
shuttle vector, pJY33E carrying Em
R
gene from pSJE. W. confusa (another
strain), and Lb. brevis 2.14 were successfully transformed with pJY33E,
and the transformation efficiency were ranged between 2.7 × 10
2
and
4.5 × 10
4
transformants/

DNA. Using Southern hybridization analysis,
single-stranded DNA intermediate was detected from Lb. brevis 2.14 cells
harboring pJY33E, indicating that pJY33 probably replicated via rolling
circle replication (RCR) mechanism. J. Y. Park, K. W. Lee were supported
by the 2nd stage Brain Korea 21 program from the Ministry of Education
and Human Resources Development, Republic of Korea.
Keywords: shuttle vector, Weissella, cryptic plasmid
I-10
Isolation and Characterization of Virulent B.cereus
Bacteriophages and uses as a B.cereus Reducer.
Eunho PARK
1
, Young-Duck LEE
2
and Jong-Hyun PARK*
1
1
Dept. of Food Science &Biotechnology, Kyungwon University, Korea.
2
College
of Life Sciences and Biothechnology, Korea University, Korea,.
*Corresponding author: p5062@kyungwon.ac.kr
Bacillus cereus is associated mainly with food poisoning and is
b
eing
increasingly reported to be a cause of serious and potentially fatal
non-gastrointestinal-tract infections. In this study, we isolated and
characterized virulent bacteriophages which have host specificity to
B.cereus. 19 virulent phages was isolated in various soil and fecal samples
using B.cereus KCTC 1094. Analyzing of the host spectrum of the isolated
virulent phages in 7 B. cereus type strains and 116 isolates were performed
by spot assay. Four phages (BCP-3, BCP-9, BCP-11, BCP-18) has
b
een
chosen due to their host specificity and these 4 phages could lyse all
seven B.cereus type strains and 126 isolated strains when they used
together as a cocktail. The morphology of the selected phages was
performed by Transmission Electron Microscopy. Also, analyzing the
proteomic pattern of phages was generated by SDS-PAGE using purified
phage particles. Inhibition growth of B.cereus by treating each phage in
LB broth was performed by UV spectrometer. Furthermore reducing o
f

B.cereus polluted raddish seads by treating bacteriophage cocktail was
performed by plate counting assay.
Keywords: Bacteriophage, B.cereus, Bacillus
I-11
Changes of Quality and Physiological Functionality of
Gugija-Liriope tuber Raw Makgeolli during Storage
Jong Soo LEE*
1
, Seung-Ye BAEK
1
, Young-Hun KIM
1
, Yun-Gyu NAM
2
and Ha-Kun KIM
1
1
Department of Life Science and Genetic Engineering, Paichai University,
Daejeon 302-735, Korea.
2
Cheongyang Boxthorn Experiment Station, Chungnam
Agric. R. &E, Service, Cheongyang 345-872, Korea.
*Corresponding author: biotech8@pcu.ac.kr
The goal of this study was to provide optimal shelf-life of Gugija-Liriope
tuber raw makgeolli. After we prepared Gugija-Liriope tuber raw
makgeolli by using Gugija, Liriope tuber, nuruk, cooked rice and
Saccharomyces cerevisiae, its changes of quality and physiological
functionality were investigated during the storage at 4°C and 20°C. Ethanol
contents was decreased from 8.3% to 7.2% for storage of 9 days at 4°C
and then was constant to 30 days storage. At 20°C storage, ethanol contents
was also decreased from 8.3% to 7.2% for storage of 6 days. pH were
not significantly changed during storage. Antihypertensive angiotensin
I-converting enzyme inhibitory activity of Gugija-Liripoe tuber makgeolli
was increased from 63.1% to 66.1% after storage for 30 days at 20°C.
Anti-gout xanthine oxidase inhibitory activity was slightly increased for
9 days storage, but its activities were very low. Total acceptability o
f

9 days storage makgeolli at 4°C was good. In conclusion, optimal storage
periods for Gugija-Liripoe tuber raw makgeolli was 9 days at 4°C in
this respect of ethanol contents, antihypertensive action and total
acceptability.
Keywords: Physiological functionality, Gugija-Liriope tuber raw makgeolli,
Storage
I-12
374
www.kormb.or.k
r

Microbial Dynamics of Commercial Makgeolli Depending on
the Storage Temperature
Hye Ryun KIM, Ae Ran LEE, Jae Ho KIM and Byung Hak AHN*
Korean Alcoholic Beverage Research Center, Korea Food Research Institute,
Gyeonggi-do 463-746, Korea.
*Corresponding author: hrkim@kfri.re.kr
A commercial makgeolli was purchased and stored in 4

and 25

for the investigation of microbial dynamics during the fermentation process
in different storage temperatures. The makgeolli samples were collected
by each 3 day interval and total DNA were extracted from all the samples.
Total bacteria were amplified with B357F-GC (5’-CGCCCGCC
GCGCCCCGCGCCCG GCCCGCCGCCCCCGCCCCCCTACGGGAGG
CAGCAG-3’)/ U519R (5’-ACCGCGGCTGCTGGCAC-3’) primer pairs
targeting V3 region of 16S rRNA gene. Total fungi were amplified
b
y
nested PCR: fungal ITS 1/2 region was amplified with ITS1F
(5’-CTTGGTCATTTAGAGGAAGTAA-3’)/ ITS4R (5’-TCCTCCGCTT
ATTGATATGC-3’) primer pairs and then inner ITS 1 region was
re-amplified with ITS1F-GC (5’-CGCCCGCCGCGCGCGGCGGGCGG
GGCGGGGGCACGGGGGGCTTGGTCATTTAGAGGAAGTAA-3’)/
ITS2R (5’-GCTGCGTTCTTCATCGATGC-3’) primer pairs. The quality
and quantity of the amplicons were analyzed by electrophoresis on 2%
agarose gel and nanodrop (ND 2000), respectively. All the amplicons was
applied to denaturing gradient gel electrophoresis (DGGE) prepared with
linear denaturing gradient of urea and formamide ranging from 30% to
60% on 8% polyacrylamide. Gel electrophoresis was carried out at a
constant voltage of 80V for 14h at 60

.
Keywords: microbial dynamics, makgeolli, DGGE
I-13
General Enzymatic Properties of Lipase from Pseudomonas sp.
INK1
Inkyung PARK and Jaiesoon CHO*
Dept. of Animal Sciences and Environment, Konkuk University, Seoul 143-701,
Korea.
*Corresponding author: chojs70@konkuk.ac.kr
A bacterial isolate displayed extracellular lipolytic activity. Based on
the 16S rRNA sequence analysis, the strain was named Pseudomonas sp.
INK1. The INK1 lipase was released into the production medium during
transition to stationary phase. The enzyme reached the apparent maximal
activity at pH 8-9, with optimal activity at 50

. The enzyme was active
against a wide range of fatty acid esters of p-nitrophenyl, showing the
highest activity towards p-nitrophenyl caprylate. The enzyme activity was
strongly inhibited by Zn
2+
and Mn
2+
, and slightly enhanced by EDTA.
Various organic solvents including isopropanol, methanol, ethanol,
acetone, n-hexane and acetonitrile significantly destabilized the enzyme
at a concentration of 15% (v/v). INK1 lipase may be a potentially useful
catalyst to enhance the buttery flavor of dairy products.
Keywords: lipolytic, Pseudomonas sp., dairy products
I-14
Study on the Mixed Culture with Micrococcus luteus for
Recovering Activity of Bacillus subtilis PL-2
Hui-Gyeong SEOL
2
, Yu-Jin KO
2
, Eun-Ja KIM
2
, Gyu-Im JOUNG
3
and
Chung-Ho RYU*
1
1
Division of Applied Life Science(BK21 program), Institute of Agriculture and
Life Science, Gyeongsang National University. Jinju 660-701, Korea.
2
D
ivision
of Applied Life Science(BK21 program), Institute of Agriculture and Life Science,
Gyeongsang National University. Jinju 660-701,Korea.
3
Cultural Institute o
f

traditional food Native local food, Jinju 11-10, Korea.
*Corresponding author: ryu@gnu.ac.kr
Due to the health benefits of Chungkukjang which is high protein traditional
fermentation product, the numerous researches on
p
hysico-chemical,
physiological, functional properties of Chungkukjang has been reported.
However, there are some problems to keep activities of strains because it is
easy to be changed according to subculture times passed. In this study, we
investigated the method to maintain activities of fermentation strains by mixed
culture. Bacillus subtilis strains were selected from mixed culture using B.
subtilis PL-2 and Micrococcus luteus KCCM 11905. Chungkukjang, fermented
with several selected strains from mixed culture, have similar qualities
compared with Chungkukjang which was fermented with strains subcultured
1~5 times. Amino nitrogen of Chungkukjang fermented with selected strains
from mixed culture were ranged from 470.93 to 673.44 mg% and mucilage
was 15 to 260 cm. Fibrinolytic and zymography activities of Chungkukjang
fermented with selected strains from mixed culture were ranged from 8.51
to 12.64 cm and 0 to 2,366.84 relative intensity. These results suggest that
mixed culture method for recovering activity of fermentation strains would
contribute to manufacture of high quality Chungkukjang product and maintain
activities of strains.
Keywords: Mixed culture, Chungkukjang, Bacillus subtilis
I-15
Antibacterial Activities of Wheat Bran Extract
Eun-Hye KA
1
, Eun-Ji CHOI
1
, Moon-Sun HAHM
2
, Myung-Hee KIM
2
,
Hae-Dong JANG
1
and Young-In KWON*
1
1
Department of Food and Nutrition, Hannam University, Daejeon 305-811,
KOREA.
2
Research Institute, Bioprogen Co. Ltd., Daejeon 306-230, KOREA.
*Corresponding author: shameka@naver.com
The antibacterial activity of wheat bran extract against food-borne
pathogens such as Staphylococcus aureus (S. aureus), Escherichia coli
(E. coli), Salmonella typhimurium (S. typhimurium), and Bacillus cereus
(B. cereus) were evaluated. Antibacterial activity was first tested in vitro
by the well diffusion assay, and then the minimum inhibitory concentration
(MIC) and Time-Kill curve of samples were determined. MIC assays were
used to quantify antibacterial activity. The MIC values of wheat
b
ran
extract showed significant antibacterial activity; the most sensitive
organism was S.aureus with an MIC of 1.25 mg/ml. Wheat bran had
higher antimicrobial activity than wheat germ and high amount of
2,6-dimethoxy- 1,4-benzoquinone (DMBQ) compared to wheat germ
extract. Results suggested that wheat processing by-product wheat
b
ran
extract which have high antibacterial activity could be developed as natural
antimicrobials and food preservatives for controlling food-borne
pathogens.
Keywords: Antibacterial, Wheat Bran
I-16
375
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Anti-viral Effects of High Molecular Weight
Poly-gamma-glutamic acid Against PRRSV
Seung Pyo HONG
1
, Hyoung-Bum KIM
1
, Ji-Hoon LEE
3
, IK-Jae KANG
3
,
Jong-Taik KIM
4
, Chul-Joong KIM
1,5
and Moon-Hee SUNG*
1,2
1
BioLeaders Corporation, Daejeon, Korea.
2
Dept. of Advanced Fermentation
Fusion Science &Technology, Kookmin University, Seoul, Korea.
3
D
ongbang
Corporation, Gyeonggi, Korea.
4
Greentherapy Corporation, Gyeonggi,
K
orea.
5
College of Veterinary Medicine, Chungnam National University, Daejeon, Korea.
*Corresponding author: sphong@bioleaders.co.kr
The porcine reproductive and respiratory syndrome virus (PRRSV) is
an infectious disease that causes abortions and respiratory disorders in
swine. Poly-gamma-glutamic acid (γ-PGA) is glutamate is polymerized
via γ-amide linkages and a safe and edible biomaterial naturally
synthesized by Bacillus subtilis subsp. chungkookjang. In the study, we
studied the positive effect of g-PGA on infected disease (PRRSV) that
causes abortions and respiratory disorders in swine. We found that
significant between the treatment groups (PGA) and control group against
highly pathogenic PRRSV in farm experiment. In weaning pig on putative
virus-infected farm, subcutaneous injection of PGA solutions (more than
2,000 kDa) resulted in increased level of body weight as well as decreased
level of a death rate compared to those of control group. Farm experiments
resulted in improvement in average body weight to 2% and a reduction
in mortality to more than 9% after 4 weeks. Hence, Poly-gamma- glutamic
acid (γ-PGA) is confirmed for its effect on body weight and morality
against PRRSV virus and it thought to be able to development as a
prophylactic material against PRRSV [This work was supported
b
y
DAEDEUK INNOPOLIS from the Ministry of Science &Technology o
f

Korea]
Keywords: PRRSV, Poly-gamma-glutamic acid
I-17
Isolation and Characterization of Protease-producing Halophilic
Bacteria isolated from Korean Fermented Anchovy
Mi Suk KANG
2
, Bo Young YUN
1
and Jin Ho LEE*
1
1
Department of Food Science and Biotechnology, Kyungsung University, Busan,
608-736, Korea.
2
Institute of Food Science and Biotechnology,
K
yungsung
University, Busan, 608-736, Korea.
*Corresponding author: jhlee83@ks.ac.kr
Three protease-producing halophiles were isolated from fermented
anchovy. Strains FAM10, 114, and 115 were identified as Salinivibrio
sp., Halobacillus sp., and Halobacillus sp. respectively, based on analyses
of 16S rDNA and 16S-23S intergenic space sequence(IGS). FAM10 had
two 16S rDNAs containing different sequences and 4 IGSs with no tRNA
gene and tRNA genes for Ile, Ala, Glu, Lys, and/or Val. FAM114 and
115 had same 16S rDNA sequence and showed 99% identity to sequences
of Halobacillus trueperi strains. The 2 IGSs displayed 99% identity to
Halobacillus aidingensis and harbored IGS
0
with no tRNA gene and IGS
IA
with tRNA genes for Ile and Ala. All of strains grew and produced protease
at salt concentration ranging 2~20%, and salinity conditions for optimum
culture and protease production were 6~18% and 6~10%, respectively.
Protease activity of FAM10 and 114 was gradually inhibited by addition
of NaCl from 2% to 14%, whereas FAM115 showed 24% activity at
14% NaCl compared to 2% NaCl. Thus, Halobacillus FAM115 was a
salt-tolerant protease producing halophilic bacterium. [This work is
financially supported by the Ministry of Knowledge Economy and Korea
Institute for Advancement in Technology through the Workforce
Development Program in Strategic Technology]
Keywords: Fermented Anchovy, Halophilic bacteria, Protease
I-18
Change of Bacterial Diversity During Dongchimi Fermentation
Based on Partial Sequences of 16S rRNA
Kye Man CHO*
1
and Han Dae YUN
2,3
1
Department of Food Science, Gyeongnam National University of Science and
Technology, Jinju 660-758, Republic of Korea.
2
Division of Applied Life Science
(BK21 Program), Gyeongsang National University, Jinju 660-701, Republic o
f

Korea.
3
Research Institute of Agriculture and Life Science, Gyeongsnag National
University, Jinju 660-701, Republic of Korea.
*Corresponding author: kmcho@gntech.ac.kr
Bacterial diversity and the composition of individual communities
during dongchimi fermentation on mass production were examined using
a PCR-based approach. Based on the 16S rDNA sequence similarity value,
a total of 14 different bacterial species were found at eight sampling sites;
Leuconostoc pseudomesenteroides, Lactobacillus alimentarius, Lactobacillus
brevis, Lactobacillus farciminis, Lactobacillus fabifermentans, Lactob-
acillus nantensis, Lactobacillus parabrevis, Lactobacillus plantarum,
Lactobacillus zymae and Lactobacillus sp., Weissella cibaria, Weissella
confusa, and Weissella sp. The prevalence of Wei. cibaria belonging to
Weissella class was the highest (86.7%) at 0 hr (0DCM stage), and
gradually decreased at the 72 hr (72DCM stage). On other hand,
L
ac.
p
lantarum observed on 36 hr (16.7%) and after it rapidly grew during
dongchimi fermentation at 84 hr (70.0%). Wei. cibaria related to the
microorganisms in initial stage of dongchimi fermentation and
L
ac.
p
lantarum rapidly grew in dongchimi produced at 32

±2 (This work
was supported Basic Science Research Program through
NRF(2010-0005480) funded by the Ministry of Education, Science and
Technology).
Keywords: Dongchimi, Bacterial diversity, 16S rDNA
I-19
Chiral Aanlysis of Glutamate by HPLC
Kwang-Hwan JHEE*
1
, Jung-Hyun KIM
1
and Seun-Ah YANG
2
1
Dept. of Applied Chemistry, Kumoh National Institute of Technology, Gumi
730-701, Korea.
2
The Center for Traditional Microorganism Resources,
Keimyung University, Daegu 704-701.
*Corresponding author: khjhee@kumoh.ac.kr
All of the amino acids derived from natural proteins are L configuration.
D-amino acids are found in nature, especially as components of certain
peptide antibiotics and in walls of certain microorganisms and recent
studies have shown that the activity of naturally occurring D-amino acid
has been revealed. For example, D-aspartic acid (D-Asp) and D-glutamic
acid (D-Glu) play important physiological roles by regulating neuronal
transmission. Although their physiological functions are not clearly
understood, significant amounts of D-amino acids also present in oriental
plants. Among oriental plants, Coptis japonica MAKINO, Hovenia dulcis,
Schisandra chinensis (Turcz.) Baill, Thuja orientalis L. have been used
for the traditional medicines for its antioxidant and neuroprotective effects.
Specifically, the Coptis and Schisandra were excellent at neuroprotective
effect. So we investigated the D,L-Glu contents in methanol extract o
f

medicinal plants by HPLC. We confirmed the D-Glu amounts of Coptis
and Schisandra were about 2 times higher than L-Glu amounts. Our data
could provide useful information about their functions and contribute to
the elucidation of the relationships between D-Glu and neuroprotective
effects.
Keywords: Glutamate, HPLC, Medicinal Plants
I-20
376
www.kormb.or.k
r

Characterization of a Putative Endolysin from a Bacillus cereus
Bacteriophage
Jaeeun PARK, Jeong-A LIM and Sangryeol RYU*
Laboratory of Molecular Food Microbiology, Department of Food and
A
nimal
Biotechnology, Department of Agricultural Biotechnology and Center
f
or
Agricultural Biomaterials, Seoul National University, Seoul 151-921, Korea.
*Corresponding author: pjae1735@gmail.com
Use of bacteriophages as biocontrol agents is promising new tool to
control pathogenic bacteria including antibiotics-resistant bacteria. In
addition to the bacteriophage itself, endolysin expressed by
b
acteriophage
to release the new virus particles from an infected cell by breaking down
the peptidoglycan layer has a high potential for application in therapy
and biocontrol. In this study, we analyzed genome sequence of the isolated
bacteriophage BPS13 active against food-borne pathogen Bacillus cereus.
To characterize endolysin encoded by BPS13, an 834bp ORF showing
homology to N-acetylmuramyl-L-alanine amidase by BLAST search was
cloned, expressed in Escherichia coli, and purified. BPS13 endolysin
(BPS13lys) showed lytic activity against Bacillus sp. and some
gram-negative bacteria such as E. coli and Salmonella sp.. BPS13lys was
stable even after boiling for 15 min. The effective pH ranged from 7
to 10.5 with optimum pH of 9.5. These results indicate that BPS13lys
is a good candidate as a new antimicrobial agent to control Bacillus sp.
Keywords: Bacillus cereus, Bacteriophage, Endolysin
I-21
Effect of Salted and Fermented Small Shrimps on
Cholesterol-lowering Effect in Rats Fed High Fat Diet
Yong Hyun KIM
1
, Kook-Il HAN
1
, Mi-Ae JEON
1
, Hyun-jung KWON
1
,
Min-Kyung PARK
2
and Man-Deuk HAN*
1
1
Dept. of Biology, College of Natural Science, Soonchunhyang University.
2
D
ept.
of Human Nutrition &Food Science, College of Engineering &Applied Sciences,
Chungwoon University.
*Corresponding author: mdhan@sch.ac.kr
This study was performed to investigate the effects of salted and
fermented shrimp ethanol extract (SFS) on serum lipid metabolism and
hepatocytes in rats. Male Sprague-Dawley rats were administerd 60% fat
feed to induce hypercholesterolemia. Experimental groups were
administered with following diets; normal diet group(NC), high cholesterol
diet group (HC), high cholesterol and shrimp extract (20

/

)
administered group (HC-SFSL), high cholesterol and shrimp extract(200

/

) administered group (HC-SFSH), high cholesterol and lovastatin
(20

/

) administered group (HC-Lov). Compared with a control group,
the serum cholesterol and triglycerides were respectively 40.4 and 64.7%
lower in the group fed HC-SFSH. Low density lipoprotein
(LDL)-cholesterol concentration in serum decreased in the HC-SFSH
group compared with HC group. In histological assay, hepatocytes in
HC-administrated rat group showed that the vacuolated cells by fat are
looking clear due to large amount of intracytoplasmic fat. Whereas, the
liver hepatocytes in the group fed SFS effectively decreased fatty liver
and intracytoplasmic fats. These results suggest that the extract of salted
and fermented shrimp have an antiatherosclerotic effect and cardiovascular
disease improvement by reducing cholesterol level of serum.
Keywords: salted and fermented shrimp, reducing cholesterol, Low density
lipoprotein-cholesterol
I-22
The Changes of Chemical and Lactic Acid Bacterial Compositions
During Takju Fermentation Using Different Nuruks
Ki-Seon YOO, Ji Eun AHN, Hee Chul LEE, Gan-Erdene OTGORBAYAR,
Ji Eun KIM, Eunyoung SEO and Nam Soo HAN*
Dept. of Food Science and Technology, Chungbuk National University, Cheongju
361-763, Korea.
*Corresponding author: namsoo@cbnu.ac.kr
Takju is a traditional Korean unrefined rice wine brewed by a complex
of microorganisms and, for inoculation of microbes nuruk is added. This
study was performed to investigate the chemical and microbiological
effects of nuruk on takju fermentation. Totally 4 types (3 commercials
and 1 laboratory made) of nuruk were used to make takju, and after 10
days (seed culture for 2 days, 1st and 2nd fermentation for 2 and 6 days)
of fermentation chemical compositions and diversity of lactic acid
b
acteria
(LAB) were analyzed. Chemical analysis result shows that takju made
of the same materials (except nuruk) using same protocol have different
compositions: 10.8-12.1% alcohol, 9.4-10.8 °Brix soluble solid,
1.29-1.74% organic acid concentrations, and pH 3.23-4.47. Microbial
analysis by using a PCR-denaturing gradient gel electrophoresis
(PCR-DGGE) result shows that each takju has their particular LAB profiles
and they are mainly originated from nuruk used. Lactobacillus,
Leuconostoc, and Weissella were detected as main LAB in takju. This
study shows that nuruk significantly affects the chemical and LAB traits
of takju and standardization of nuruk preparation method is very important
for the production of high quality takju.
Keywords: takju, nuruk, lactic acid bacteria
I-23
Bacterial Counts and Enzyme Activities during Aging of Korean
Soy Sauce Prepared with Different Soybean Cultivars
Keum Ok KIM and Yong Suk KIM*
Department of Food Science &Technology, Chonbuk National University,
J
eonju,
Jeonbuk 561-756, Korea.
*Corresponding author: kimys08@jbnu.ac.kr
In order to select the most ideal soybean cultivars for preparation o
f

Korean soy sauce, bacterial counts and enzyme activities of Korean soy
sauce prepared with 11 soybean cultivars were investigated during aging
for 60 days at an interval of 15 days. Aerobic bacterial counts of soy
sauce were ranged from 6.70 (Taekwang) to 8.97 (Saeol) log CFU/g during
aging. Anaerobic bacterial counts were maintained in the range of 6.00
(Daol) ~ 7.44 (Daewon) log CFU/g. Acidic protease activities were ranged
from 0.217 (Danbaek) to 0.587 (Daewon) unit/mL during aging. Neutral
protease activities were changed from 0.245 (Danbaek) ~ 0.504 (Daewon)
unit/mL at the initial stage to 0.297 (Danbaek) ~ 0.584 (Daewon) unit/mL
after 60 days of aging. α-Amylase activities were in the range of 0.448
(Danbaek) ~ 2.548 (Milyang192) unit/mL at the initial stage and gradually
decreased up to 60 days of aging. β-Amylase activities were in the range
of 52.167 (Daewon) ~ 96.056 (Jinpum2) unit/mL at the initial stage and
increased up to 30 days of aging, but decreased after 60 days of aging.
In conclusion, there was some varied in bacterial count according to
soybean cultivars. Enzyme activities of soy sauce prepared with
Milyang192, Daewon, and Taekwang soybeans were higher than those
of other soy sauce.
I-24
377
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Prevalence and Characterization of Plasmid-Mediated Quinolone
Resistance Genes in Escherichia coli Isolated from
Antimicrobial-Free, Conventional Swine Farms, and Community
Hospital Patients
Min-Jeong KIM
1
, Min-Tae KIM
1
, Haet-Nim YOON
1
, Jae-Won KIM
2
,
Hyo-Sun KWAK
3
and Gun-Jo WOO*
1
1
Laboratory of Food Safety and Evaluation, Department of Food Bioscience and
Technology, Korea University, Seoul 136-713, Korea.
2
Bioscience Research
Center, CJ CheilJedang, Seoul 157-200, Korea.
3
Korea Food and
D
rug
Administration, Cheongwon-gun, Chungcheongbuk-do 363-700, Korea.
*Corresponding author: visionkorea@korea.ac.kr
Quinolones have been used to treat infections in food-producing animals,
and their use has increased in resistance to enteric pathogens and commensal
bacteria. Resistance to quinolones is mainly due to mutations in topoisomerase
genes and plasmid mediated quinolone resistance (PMQR). There is limited
information on the incidence of these resistance determinants and the
relationship among swine and human E. coli isolates in the same
p
rovinces,
Korea. We characterized PMQR among nalidixic acid resistant E. coli isolates
from swine and human in three provinces, Korea. Of the 162 nalidixic acid
resistant E. coli isolates (swine, 83/246; human, 79/178) screened by minimal
inhibitory concentration assay (MIC≥32), 43.2% (swine, 32/83; human, 38/79)
were resistant to ciprofloxacin. PMQR determinants, qnrA, qnrB, qnrD, qnrS,
and aac(6’)-Ib-cr were analyzed by PCR and DNA sequencing. The qnrS1
was the most prevalent PMQR gene in swine isolates (n=10), while the
aac(6’)-Ib-cr variant was the most common in humans(n=6), and two clinical
isolates were positive for qnrB4, but qnrA, B1, or D was not detected. In
this study, the wide distribution of PMQR genes which play a role for high
levels of fluoroquinolone resistance was observed in antimicrobial-free,
conventional swine farms and humans.
Keywords: Antimicrobial resistance, PMQR, Escherichia coli
I-25
Intestinal Adhesion Ability of Lactic acid Bacteria Isolated from
Kimchi
Eun Hye RYU and Hae Choon CHANG*
Dept. of Food and Nutrition, Research Center for Kimchi, Chosun university,
Gwangju 501-759, Korea.
*Corresponding author: stargirl1208@nate.com
Adherence to human intestinal cell lines, Caco-2 cells and the ability
to colonize the gastrointestinal tract should be estimated during
preselection and assessment of probiotic strains. Ten lactic acid
b
acteria
(LAB) isolated from kimchi were evaluated to determine the adhesion
ability to Caco-2 cells. The adhesion of the LAB to Caco-2 cells was
expressed as a percentage of the viable bacteria compared to their initial
population (10
8
CFU/mL) in the bacterial suspension. The adhesion
capacities of the strains were compared to that of the well-known probiotic
strain, Lactobacillus rhamnosus GG (1.02%). Most of the strains tested
had low adhesion to Caco-2 cell (0.09~0.84%), while the two strains,
Leuconostoc kimchii GJ2 (1.89%) and Pediococcus pentosaceus MP1
(1.95%) showed the highest adherence ability. Additionally, their
adhesions to Caco-2 cells were observed with gram-stained cells under
microscope.
Keywords: adhesion, lactic acid, Caco-2 cell
I-26
Preparation of Korean traditional soy sauce using
S
alicornia
herbacea L. and Oryza sativa L.
Bo Young JEON, Ji Yeon JEONG, Sang Min MA and Doo Hyun PARK*
Department of Biological Engineering, Seokyeong University, Seoul 136-704,
Korea.
*Corresponding author: baakdoo@skuniv.ac.kr
Four types of meju were made from 100% defatted soybean (DFS),
a mixture of 80% defatted soybean and 20% glasswort (DFS-G), a mixture
of 80% defatted soybean and 20% rice (DFS-R), and a mixture of 60%
defatted soybean, 20% glasswort, and 20% rice (DFS-GR). Four types
of Korean traditional soy sauce were prepared from the four types o
f

meju. Mineral and antioxidant contents in the soy sauce made of DFS-G
and DFS-GR were significantly higher than others. Citric, malic, succinic,
lactic, and pyroglutamic acid contents in soy sauce made of DFS-R and
DFS-GR were 1.3-1.5 times higher than others. Total nitrogen and free
amino acid contents in soy sauce were correlated with DFS concentration
in the meju. The bacterial community in the non-fermented meju-making
ingredients was replaced largely by Bacillus sp. in the fermented meju.
The use of glasswort and rice in the meju-making process did not alter
the bacterial community responsible for the fermentation of meju.
Acknowledgement This research was supported by the Technology
Development Program for Agriculture and Forestry, Ministry of
Agriculture and Forestry, Republic of Korea (109147-03-2-HD120).
Keywords: Korean traditional soy sauce, meju, glasswort, rice, TGGE
I-27
Expression of Bacillus anthracis Protective Antigen in Bacillus
subtilis
Da-Eun JEONG
1
, Seung-Hwan PARK
1
, Eui-Joong KIM
2
and
Soo-Keun CHOI*
1
1
1Industrial Biotechnology &Bioenergy Research Center, Korea Research
Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu,
Daejeon 305-806, Korea.
2
Genofocus Inc., Daejeon, Korea.
*Corresponding author: sookeun@kribb.re.kr
Bacillus anthracis, the etiological agent of anthrax, produces an exotoxin
consisting of three proteins; lethal factor (LF), edema factor (EF), and
protective antigen (PA). The PA is the primary immunogenic component
of the human anthrax vaccines. We have tried to express the PA in
B
.
subtilis using our proprietary expression system, but it was not successful.
The reason suggested that the secreted PA might be degraded by numerous
extracellular proteases. To overcome this problem, the spo0A/lytC mutants
or protease-deficient strain were used as the alternative hosts in which
the activities of extracellular proteases were not detected. SDS-PAGE
analysis and Western hybridization revealed that the PAs in those mutants
were highly expressed and secreted into the culture supernatant. The results
indicate that the secreted PA can be easily degraded by B. subtilis
extracellular proteases. Thus, elimination of the extracellular proteases
from the expression host is necessary for the overexpression of the PA
in B. subtilis. [Supported by the 21C Frontier Microbial Genomics and
Applications Center Program, MEST, and the Technology Development
Program for Agriculture and Forestry, Ministry for Agriculture, Forestry
and Fisheries, Republic of Korea]
Keywords: protective antigen, Bacillus subtilis, extracellular proteases
I-28
378
www.kormb.or.k
r

Improvement Effect of Fermented Silkworm (Bombyx mori L.)
Powder on the Alcoholic Hepatotoxity
Jae Hong LEE
2
, Hee Young AHN
2
, Su Jin HEO
2
, Min Jeong KANG
2
,
Kyu Rim PARK
1
and Young Su CHO*
1
1
Department of Biotechnology, Dong-A University, Busan 604-714,
K
orea.
2
Department of Medical Biosciences, Graduate School, Dong-A University, Busan
604-714, Korea.
*Corresponding author: jalmong@nate.com
The purpose of this study was to investigate the protective effect o
f

silkworm, Bombyx mori L. fermented with Bacillus subtillis (SPFB) and
Aspergillus kawachii (SPFA) on alcohol-induced hepatotoxicity in rats.
Alcohol-feeding Sprague-Dawley rats were fed diets containing silkworm
powder (SP) or both BFSP and SPFA at the 5% (w/w) levels for 4 weeks.
Alcohol administration resulted in significantly increase in the activities
of the liver marker enzymes, AST, γ-GTP, and LDH and the levels of
blood alcohol and acetaldehyde, relative to the normal rats. Interestingly,
SPFB administration drastically increased both hepatic ADH and ALDH
activities in comparison to both SP and SPFA, thus SPFB would be more
effective in the reduction of blood alcohol and acetaldehyde. Also, alcohol
treatment resulted in increased lipid peroxidative index and decreased the
antioxidant status in the liver and serum was observed. SPFB treatment
improved the antioxidant status of alcoholic rats. The concentrations of
serum total cholesterol and free fatty acid and hepatic triglyceride were
increased when alcohol was treated but these parameters were significantly
decreased by SPFB treatment. These effects were more pronounced in
the SPFB than that in PS or SPFA in alcohol treatment rats.
Keywords: Silkworm powder, Bacillus subtillis, Aspergillus kawachii
I-29
Hemicellualse Production by Mycobacterium sp. Isolate
Ki-Hong YOON* and Min A KIM
Department of Food Science &Biotechnology, Woosong University, Korea.
*Corresponding author: ykh@wsu.ac.kr
A bacterium producing the extracellular mannanase and xylanase was
isolated from Korean soil by successive subcultures in a minimal medium
supplemented with rice bran. The isolate WL-1106 has been identified
as Mycobacterium sp. on the basis of its 16S rRNA sequence. The
additional carbohydrates including locust bean gum (LBG) and palm kernel
meal (PKM) increased the mannanase productivity of strain WL-1106,
while the xylanase productivity of the isolate was increased by wheat
bran, oat spelt xylan and rice. LBG induced mannanase production more
than PKM, and wheat bran also induced xylanase production more than
xylan or rice bran. When the isolate cultured in LB broth supplemented
with the mixture of palm kernel meal and wheat bran, both of xylanase
and mannanase was poorly produced by the isolate. The mannanase o
f

culture supernatant in tryptic soy broth (TSB) supplemented with LBG
(1%) was the most active at 50

and pH 6.0, and the xylanase of culture
supernatant in TSB supplemented with wheat bran (2 %) the most active
at 55

and pH 6.0-6.5.
Keywords: Mycobacterium sp., xylanase, mannanase
I-30
1,4-Dihydroxy-2-Naphthoic Acid (DHNA) Production from
Leuconostoc mesenteroides CJNU 0147 Transformant Which
Overexpresses menB Gene Encoding DHNA Synthase
Gi-Seong MOON* and Ji-Eun EOM
Dept. of Biotechnology, Chungju National University, Jeungpyeong 368-701,
Korea.
*Corresponding author: gsmoon@cjnu.ac.kr
1,4-Dihydroxy-2-naphthoic acid (DHNA), precursor of menaquinone
(vitamin K
2
), has an effect on the stimulation of the growth of
bifidobacteria and prevention of osteoporosis. So it might be very
promising functional food material. For that reason, we have tried to isolate
menB gene encoding DHNA synthase from Leuconostoc mesenteroides
CJNU 0147 strain. Based on the genome sequence of Leu. mesenteroides
ATCC 8293 (GenBank accession no., CP000414), Leu_menBfull_F and
Leu_menBfull_R primer set was designed and used for the PCR
amplification of menB gene of CJNU 0147 strain. From the PCR, 1.2
kb of DNA fragment was amplified and cloned into pGEM-T Easy vector,
and sequnced. MenB (DHNA synthase) protein of CJNU 0147 strain had
a similarity to the corresponding protein of ATCC 8293 with 98%. The
menB gene was subcloned into pCW4, a lactic acid bacteria-E. coli shuttle
vector, and transferred into CJNU 0147 strain. The transcription level
of menB gene of CJNU O147 (pCW4::menB) was much increased
compared with those of CJNU 0147 (pCW4) and CJNU 0147 (-). DHNA
was detected from only MRS culture of CJNU 0147 (pCW4::menB)
indicating that menB gene of CJNU 0147 encodes DHNA synthase and
the overexpressed enzyme might have an influence on higher DHNA
production of CJNU 0147 (pCW4::menB).
Keywords: 1, 4-dihydroxy-2-naphthoic acid, Leuconostoc mesenteroides,
DHNA synthase
I-31
Development of Korean Traditional Soy Sauce Supplemented
with Salicornia herbacea L.
Bo Young JEON, Da Hye JOO, Han Sol YU and Doo Hyun PARK*
Department of Biological Engineering, Seokyeong University, Seoul 136-704,
Korea.
*Corresponding author: baakdoo@skuniv.ac.kr
Five types of meju were prepared from 100% defatted soybean (DFS0),
a mixture of 90% DFS and 10% glasswort (DFS1), a mixture of 80%
DFS and 20% glasswort (DFS2), a mixture of 70% DFS and30% glasswort
(DFS3), and a mixture of 60% DFS and 40% glasswort (DFS4). Five
types of kanjang were separately prepared from the 5 types of meju
b
y
ripening in brine for 6 months. The contents of minerals, organic acids
and antioxidative effect in the kanjang were increased in proportion to
the glasswort content in the meju. However, the free amino acid contents
in the kanjang were reduced in proportion to the glasswort content in
the meju. DFSG1- and DFSG2-kanjang were not different distinctly from
DFSG0-kanjang based on aroma, flavor, and taste in the panel test. The
bacterial and fungal community in the fermented meju and kanjang was
not affected by the addition of glasswort to the meju-making process.
In conclusion, the glasswort was a supplement that nutritionally improved
the kanjang but didn’t influence the growth of microorganisms that are
responsible for the fermentation of meju and kanjang. Acknowledgement
This research was supported by the Technology Development Program
for Agriculture and Forestry, Ministry of Agriculture and Forestry,
Republic of Korea (109147-03-2-HD120)
Keywords: glasswort, meju, kanjang, organic acids, amino acids, microbial
community
I-32
379
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Characterization of a Novel Bacteriocin, Cerein 13061, Produced
from Bacillus cereus ATCC 13061
Jeong-A LIM, Minjeong KIM, Eunmi SHIN and Sangryeol RYU*
Department of Food and Animal Biotechnology, Department of
A
gricultural
Biotechnology, Center for Agricultural Biomaterials, and Research Institute
f
or
Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea.
*Corresponding author: hanli56@hanmail.net
Bacteriocins are natural antimicrobial substances produced by certain
microorganisms. A novel bacteriocin, named cerein 13061, was identified
from Bacillus cereus ATCC 13061. This bacteriocin was purified through
hydrophobic interaction chromatography followed by reverse-phase
HPLC. Cerein 13061 consists of two distinct peptides, whose
complementary action is necessary for full antimicrobial activity. Their
molecular weights, as determined by mass spectrometry, were 2697.5 Da
and 2883.3 Da, respectively. Partial amino acid sequences of the individual
peptides have been identified and their deduced genes are found to
b
e
located on the chromosome. Cerein 13061 does not have any homology
to known bacteriocins and has a low isoelectric point value of 4, suggesting
that cerein 13061 is a new bacteriocin. Cerein 13061 has
b
actericidal
activity against most B. cereus and Listeria monocytogenes strains at a
broad range of pH and temperature, and has the potential to be used as
an antibacterial agent.
Keywords: bacteriocin, Bacillus cereus, antibacterial agent
I-33
Screening for L-lactic Acid-producing Bacteria from Tradictional
Korean Foods for Industrial Potential from a Freshwater Green
Alga
Mai Cuong NGUYEN, Myoung Soo PARK, Gyung Ja CHOI,
Yong Ho CHOI, Kyoung Soo JANG, Jin-Seok KIM and Jin-Cheol KIM*
Chemical Biotechnology Research Center, Green Chemistry Division,
K
orea
Research Institute of Chemical Technology, Yuseong-Gu PO Box 107,
D
aejeon
305-600, Republic of Korea.
*Corresponding author: kjinc@krict.re.kr
A total of 131 lactic acid (LA)-producing bacterial strains were isolated
from 27 fermented food samples. Among them, 31 and 10 strains produced
L-isomer and D-isomer over 90%, respectively. Eleven homofermentative
strains producing L-isomer more than 90% were screened according to
their production and technological properties. Two strains of
L
actobacillus
p
aracasei LA104 and LA128 could grow at initial pH 3, at 60 g lactic
acid/

, or at 200 g glucose/

. Their maximum tolerance concentrations
to NaCl were 125 g NaCl/

for LA104 and 75 g/

for LA128. They
could use various hexoses except rhamnose, but not pentoses. The strains
also could use disaccharides such as saccharose and maltose, but not
lactose. They required low concentration of yeast extract to grow as
compared to other strains and displayed over 94.5% and 98% product
stereospecificity and productivity of 5.1 and 3.84 g LA/

/h at 100 g
glucose/

in batch fermentation, respectively. We investigated the
production rate of LA of LA104 from a freshwater green alga (HR) through
a simultaneous saccharification and fermentation. The strain LA104
converted most of reducing sugars to LA after 24 hours at 120 g dried
material/

with production rate of 100% (% g LA/g reducing sugars)
or 50% (% g LA/g dried material).
Keywords: Lactobacillus paracasei, lactic acid, freshwater green alga
I-34
Screening for Phomopsis sp. Produced Materials for Biocontrol
of Phytophathogenic Fungi
Hee Sun KO
2
, Hyun Soo KIM
2
and Sung Kee HONG*
1
1
Crop Protection Division, National Academy of Agricultural Science, RDA,
Suwon 441-707, Korea.
2
Dept. of Microbiology, Keimyung University,
D
aegu
704-701, Korea.
*Corresponding author: hippang@hanmail.net
We investigated the ability of ~90 phomopsis genus related strains,
gathered throughout the country, to biologically control 14 types of
phytopathogenic fungi. Each strain was cultured at 25

and 180 rpm,
in PDB for 5 days. A 50 uL aliquot of the culture-filtrate (CF) was
inoculated onto a paper disc and applied to a PDA plate containing the
spores of each phytopathogen. Strain P21 greatly inhibited the growth
of Botrytis cinerea. It was determined that a 4-5 day incubation was more
effective than an incubation lasting >6 days. To investigate the heat
stability of the antifungal substance, we preheated samples at 40, 50, 60,
or 100

for 10 minutes. The heat-treated samples showed antifungal
activity up to a processing temperature of 60

, but activity was not
detected at a temperature of 100

. When an equal amount of ethyl acetate
was added to the culture broth and the broth was extracted for 24 h with
shaking, antifungal activity was only present in the ethyl acetate layer.
An in vivo test was conducted by planting cucumber seeds and spraying
the growing leaves with P21 CF. Later, the leaves were cut into discs,
dipped into a solution containing B. cinerea spores, and then cultured
at 25

. P21 CF - sprayed leaves were more resistant to B. cineria than
leaves with only PDB.
Keywords: Phomopsis sp., Botrytis cinerea, Biocontrol
I-35
Multiplex and Quantitative Pathogen Detection using
MLPA-CE-SSCP
Boram CHUNG
1
, Gi Won SHIN
1
, Hee Sung HWANG
1
, Jeongkyeong NA
1
and Gyoo Yeol JUNG*
1,2
1
I-Bio program, Postech, Korea.
2
Dep. of Chemical Engineering, Postech, Korea.
*Corresponding author: tupset@postech.ac.kr
Food safety is a global health goal and the foodborne diseases take
a major crisis on health. Therefore, detection of microbial pathogens in
food is the solution to the prevention and recognition of problems related
to health and safety. Conventional bacterial detection methods such as
culture and colony counting methods may take up to a few days to yield
an answer. Obviously this is inadequate, and recently many researchers
are focusing towards the progress of rapid methods.Here, we demonstrate
the rapid method which multiplex pathogen detection method based on
capillary electrophoresis-single strand conformation polymorphism
(CE-SSCP) coupled with multiplex ligation-dependent probe amplification
(MLPA). MLPA-CE-SSCP is composed of four major steps which are
probe hybridization, probe ligation, multiplex amplification and SSCP
detection by CE. Using ten foodborne pathogens as a model set, all the
four MLPA-CE-SSCP steps were carefully optimized to sensitively detect
and precisely quantify by MLPA-CE-SSCP. As a result, all ten pathogens
could respectively identify and the method had a limit of detection of
0.5~5 pg and a dynamic range of 10
2
. These results indicate that
MLPA-CE-SSCP system have considerable potential in clinical diagnosis,
food safety, and biosafety.
Keywords: MLPA-CE-SSCP, Foodborne-illness pathogen detection,
Mulitplex detection
I-36
380
www.kormb.or.k
r

Starter Characteristics of Lactic Acid Bacteria Isolated from
Makgeolli
Tae-Heung PARK
1
, Seung-Gyu LEE
1
, Nam Soo HAN
3
, Jeong Hwan KIM
1,2
and Jeong Hwan KIM*
1,2
1
Graduate School, Gyeongsang National University, Jinju 660-701, Republic o
f

Korea.
2
Institute of Agriculture and Life Science, Gyeongsang National
University, Jinju 660-701, Republic of Korea.
3
School of
A
gricultural
Biotechnology, and Center for Agricultural Biomaterials.
*Corresponding author: jeonghkm@gsnu.ac.kr
The objective of this study was to isolate the represeatative lactic acid
bacteria (LAB) from makgeolli, and study their properties. LAB were
isolated from makgeolli sample. Principally, homogenized and serial
diluted makgeolli sample was spread onto MRS plates incubated at 30

for 2-3 days. From a plate, a single colony was picked and cultivated
in 1 ml MRS broth for stock preparation. A stock of 200 isolates was
obtained. Out of 200 strains screened, 11 strains showed color change
on X-gal plates .Identification of 11 strains by Api kit and 16s rRNA
gene sequence revealed that all strains were Lactobacillus
p
lantarum.
Furthermore, 5 out of 11 strains identified showed significant β
-galactosidase activity and 4 strains showed β-glucosidase activity. Other
properties are currently under study and will be presented at the meeting.
T. H. Park, S. G. Lee were supported by the 2nd stage Brain Korea 21
program from the Ministry of Education and Human Resources
Development, Republic of Korea.
Keywords: makgeolli, B-galactosidase, B-glucosidase
I-37
Enhancement of the Immune Responses of Olive Flounder
Paralichthys olivaceus by Enterococcus faecium
Yu-Ri KIM
1
, Won-Seok HEO
1
, Eun-Young KIM
1
,
Muhammad Tofazzal HOSSAIN
1
, Ryunkyong OH
1
, Young Chai CHO
2
and
In-Soo KONG*
1
1
Dept. of Biotechnology, Pukyong National University, Daeyun 3-dong, Busan,
Korea.
2
Centre for Marine Biotechnology &Bioengineering Research, amBio Co.
Ltd,.
*Corresponding author: iskong@pknu.ac.kr
Probiotics have been proposed to be effective in the prevention of
pathogenic bacteria. The present study was aimed to investigate the effect
of probiotic, Eterococcus faecium, on the immune responses against the
infection with Lactococcus garvieae, which is marine fish pathogen, in
olive flounder (Paralichthys olivaceus). About ~10
9
cells of E. faecium
were injected to fish and then challenged intraperitoneally with L. garvieae
for up to 15 days at 2 days. The immune responses were assessed
b
y
lysozyme activity, complement activity, protease activity and stimulation
of proinflammatory cytokines, such as TNF-α, IL-1β, and IL-6
b
y
RT-PCR. E. faecium was found to be effective in the induction of immune
responses in olive flounder against L. garvieae. The lysozyme activity
and complement activity were increased between 9-15 and 9-13 days,
respectively, and antiprotease activity was also significantly elevated after
5 days of probiotic treatment. The TNF-α expression was observed after
11 days, and IL-1β expression was appeared strongly at 13 days from
kidney and spleen. The results of this study reveal that an injection with
E. faecium to olive flounder protects the fish from the infection of
L
.
garvieae.
Keywords: Enterococcus faecium, Olive flounder, Immune response
I-38
Genetic Regulation of Carocin D Biosynthesis in
P
ectobacterium
carotovorum subsp. carotovorum Pcc21
Mukesh KUMAR, Shweta MALHOTRA, Yangkyun KIM, Dong Hwan LEE,
Sook-young JANG, Kyu Suk JUNG, Eunjung ROH, Jongchul YUN and
Sunggi HEU*
Microbial Safety Division, National Academy of Agricultural Science, RDA,
Suwon 441-707.
*Corresponding author: heu@rda.go.kr
Bacteriocin inhibits the growth of same or closely related
b
acterial
species. Previously, we reported new bacteriocin, carocin D, produced
by P. carotovorum subsp. carotovorum Pcc21. Carocin D was encoded
by caroDK gene located in the genomic DNA along with the caroDI gene,
which encodes immunity protein. To study the regulation of
b
acteriocin
activity, transposon mutagenesis against Pcc21 strain was carried out, and
5,200 mutants were examined for change in bacteriocin activity. The
bacteriocin activity of 50 transposon mutants decreased and of 9 mutants
increased significantly. Analysis of mutant sequences revealed that 4 genes
including transcriptional regulator CopG family were related with up
regulation while 10 genes including transcriptional activator RfaH were
related with down regulation of carocin D synthesis. Sequence analysis
of Carocin D locus revealed that both CaroDK and CaroDI genes are
present as an operon and are regulated by single promoter present at
upstream of CaroDK gene To further delineate the promoter region o
f

Carocin D deletion clones have been made in promoterless GFP reporter
vector pPROBE-AT. The GFP reporter cassette will be transformed in
transposon mutants to study the interaction of regulatory genes and Carocin
D biosynthesis
Keywords: carocin D, Pectobacterium
I-39
Isolation of Leuconostoc and Weissella Species Inhibit the Growth
of Lactobacillus sakei from Kimchi.
Kwanghee LEE and Jong-Hoon LEE*
Department of Food Science and Biotechnology, Kyonggi University, Suwon
443-760, Korea.
*Corresponding author: jhl@kyonggi.ac.kr
Kimchi is a group of traditional fermented vegetable foods in Korea
and known to be the product of a natural mixed-fermentation process
carried out principally by lactic acid bacteria (LAB). According to the
microbial studies based phylogenetic identification, a variety of
Leuconostoc and Lactobacillus species those were not detected in the early
studies have been detected together with the species in the genus Weissella.
Additionally, Lb. sakei has been accepted as the most populous LAB in
over-ripened kimchi. Leuconostoc and Weissella species inhibit the growth
of Lb. sakei were isolated from kimchi for future application as a starter
to delay the over-ripening of kimchi. From 25 kimchi samples, 378 strains
in the genera Leuconostoc and Weissella were isolated and 68 strains
identified as Lc. mesenteroides, Lc. citreum, Lc. lactis, W. cibaria, W.
confusa, and W. paramesenteroides showed growth inhibition against
L
b.
sakei. Most of the strains also had antagonistic activities against Lb. brevis,
Lb. curvatus, Lb. paraplantarum, Lb. pentosus, and Lb. plantarum.
L
c.
mesenteroides CK0122 produced a heat- and pH-stable proteinaceous
antimicrobial compound, which has antagonistic activity against a
b
road
spectrum of microorganisms. The molecular mass of BLIS was less than
3,000 Da.
I-40
381
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Analysis of Bacterial and Fungal Communities during a
Gugija-Liriope tuber Makgeolli Fermentation and Storage
Jong Soo LEE*
1
, Jin-Hong MIN
1
, Jung-Il JU
2
and Ha-Kun KIM
1
1
Department of Life Science and Genetic Engineering, Paichai University,
Daejeon 302-735, Korea.
2
Cheongyang Boxthorn Experiment Station, Chungnam
Agric. R. &E. Service, Cheongyang 345-872, Korea.
*Corresponding author: biotech8@pcu.ac.kr
We brewed Gugija-Liriope tuber Makgeolli for 1 week with two-stage
fermentations and stored them for 1 month at 4ºC and 20 ºC in order
to assess the change of microbial numbers and microbial flora by using
the viable cell counts and denaturing gradient gel electrophoresis (DGGE)
of PCR-amplified rRNA genes, respectively. Fungi were decreased to
38.9% and 4.8% after storage for 30 days at 4°C and 20°C,respectively.
Bacteria were cell counts also were decreased to 26.1% of initial cell
counts for 30 days at 4°C . In the storage at 20°C, bacteria were
significantly decreased to 15.5% of initial cell counts after storage for
3 days. Three types of bacteria were identified from the DGGE analysis
for 16S rRNA genes, Weissela confuse was dominant species at the initial
stage of fermentation and it was replaced by Lactobaciius fermentum and
Pediococcus acidilactis at the final stage of fermentation. Intensity of the
band for Pediococcus acidilactis was consistent during the experimental
periods. However, the bands for the W. confuse and L. fermentum were
decreased. The fungal DGGE profile indicated that Saccharomyces
cerevisiae were major dominant species during the experimental periods
and Saccharomyces sp. was diminished at the end of the storage.
Keywords: Viable cell count, Gugija-Liriope tuber makgeolli, storage
I-41
Characterization of bacteriocin Produced by Mannitol-Producing
Leuconostoc citreum GR1 isolated from Kimchi
Ji Yoon CHANG and Hae Choon CHANG*
Dept. of Food and Nutrition, Kimchi Research Center, Chosun University,
501-759, Gwangju, Korea.
*Corresponding author: ienvyu00@hanmail.net
A lactic acid bacterial strain showing high mannitol production was
isolated from Kimchi. The isolated strain GR1 was designated as
Leuconostoc citreum GR1 based on biochemical properties, and 16S rRNA
sequencing. The conversion rate from fructose to mannitol by
L
euc.
citreum GR1 was quite high; 0.68g of mannitol was produced from
L
euc.
citreum GR1 culture in LM medium supplemented with 5% fructose for
48h. Leuc. citreum GR1 showed also antibacterial activity against various
species of Gram-positive and Gram-negative bacteria. The
b
acteriocin
activity was degraded by proteolytic enzymes (trypsin, protease, proteinase
K), and it was stable at high temperatures (121

, 15min), but it was
unstable over pH 4.0. Bacteriocin production was increased when GR1
was cocultivated with thermally inactivated cell and cell debris of
bacteriocin-sensitive strains, Lactobacillus plantarum KFRI 464 or
Lactobacillus delbruekii KFRI 347.
Keywords: mannitol, bacteriocin, bacteriocin induction
I-42
Metabolite Profiling and Bioactivity of Rice koji Fermented by
Aspergillus Strains
Hyangyeon KIM
1
, Ah jin KIM
1
, Jung Nam CHOI
1
, Jiyoung KIM
1
,
Soo Hwan YEO
2
, Ji Ho CHOI
2
and Choong Hwan LEE*
1
1
Dept. of Bioscience and Biotechnology, Konkuk University, Seoul 143-701,
Korea.
2
Fermentation &Food Processing Division, National Academy o
f

Agricultural Science, RDA, Suwon 441-707, Korea.
*Corresponding author: chlee123@konkuk.ac.kr
In this study, the metabolite profiles of three Aspergillus strains during
rice koji fermentation were compared. In the partial least squares
discriminant analysis based gas chromatography-mass spectrometry data
sets, the metabolite patterns of A. oryzae (KCCM 60345) were clearly
distinguished from A. kawachii (KCCM 60552) and only marginal
differences were observed for A. oryzae (KCCM 60551) fermentation.
In the 2 d fermentation samples, the overall metabolite levels of A. oryzae
(KCCM 60345) were similar to the A. oryzae (KCCM 60551)’s levels
and lower than the A. kawachii (KCCM 60552)’s levels. In addition, we
identified discriminators which were mainly contributing tyrosinase
inhibition (kojic acid) and antioxidant activities (pyranonigrin A) in
A
.
oryzae (KCCM 60345) and A. kawachii (KCCM 60552) inoculated rice
koji, respectively. In this study, we demonstrated that the optimal inoculant
Aspergillus strains and fermentation time for functional rice koji could
be determined through metabolomics approach with
b
ioactivity
correlations.
Keywords: Koji, Aspergillus, antioxidant activities, tyrosinase inhibition
I-43
Characterization, Screening, Antifungal and Anti-Yeast Activity
of Bacteria Isolated from Kimchi
Irfan RATHER
1
, Byoung Joo SEO
1
, Jeongheui LIM
1
, Byung-Hee RYU
2
,
Woel Kyu HA
2
and Yong-Ha PARK*
1
1
Department of Applied Microbiology and Biotechnology, Yeungnam University.
2
R&D center, Daesang FNF Co., Seoul, Republic of Korea.
*Corresponding author: erfaan21@gmail.com
The antifungal and anti-yeast activities of about 1400 bacteria isolated
from different Kimchi samples were investigated against test strains o
f

pathogenic and food spoilage microorganisms. The aims of this study was
to isolate novel Lactic Acid Bacteria (LAB) from Kimchi with antifungal
and anti-yeast properties, characterize their inhibitory activity and apply
the selected inhibitory strains to prevent fungal and yeast deterioration
of food and feed. The cell-free supernatant of seven bacteria inhibited
the growth of Aspergillus niger KCTC16683, Aspergillus
f
lavus
KCTC16682, Fusarium oxysproum KCTC6434, Fusarium oxysproum
KCTC16909, Aspergillus oryzea, Candida albicans, Saccharomyces
cerevisiae, Kazachstania aerobia, Pichia membranifaciens and
Zygosaccharmyces rouxii. Fungal growth was clearly inhibited
b
y
co-cultivation, both in terms of the total mass of produced mycelia and
morphological changes. The mycelia dry weight in the co-cultivation was
1-6% of the control. The results indicate that LAB with fungal inhibitory
properties can be useful in biopreservation of both food and feed, alone
or in combination with other microorganisms.
Keywords: Probiotics, Biopreservation, Lactic Acid Bacteria (LAB)
I-44
382
www.kormb.or.k
r

Application of Supercritical Carbon Dioxide for the Inactivation
of Penicillium oxalicum Spores in the System of Barley or Wheat
Seeds
Hyong Seok PARK, Yong Ho LEE, Wook KIM and Kyoung Heon KIM*
School of Life Sciences and Biotechnology, Korea University, Seoul 136-713,
Republic of Korea.
*Corresponding author: khekim@korea.ac.kr
Supercritical carbon dioxide (SC-CO
2
) was exploited in the inactivation
of Penicillium oxalicum spores in wheat and barley seeds, and the
germination capabilities of both seeds treated with SC-CO
2
were examined.
The inactivation yields of both seeds increased as all independent variables
increased such as the concentration of cosolvent (0-300 µl, water), the
treatment temperature (40-50°C) and the treatment time (10-30 min).
Especially, the inactivation yields of P. oxalicum spores in both wheat
and barley seeds were significantly affected by the presence of cosolvent.
The optimal inactivation conditions of wheat and barley seeds, which was
predicted by the response surface methodology, were 233 µl of cosolvent
(water), 44°C and 11 min, with the expected inactivation yield of 6.41
log and 231 µl of cosolvent, 44°C and 12 min, with the expected
inactivation yield 6.75 of log, respectively. The germination capabilities
of wheat and barley seeds were reduced as the severity of treatment
conditions increased. Acknowledgment: This work was supported by the
BioGreen 21 Program (20070301034019), Rural Development
Administration, Republic of Korea.
Keywords: Supercritical carbon dioxide, Fungal spore, Inactivation
I-45
Quality Properties of Brown Rice Vinegar by Fermentation
Methods
Soo-Hwan YEO*
1
, Joo-Yeon KIM
1
, Ji-Ho CHOI
1
, Chang-Ho BAEK
1
,
Han-Seok CHOI
1
, Seong Yeol BAEK
1
, Hye Sun CHOI
1
, Hye-Young
PARK
1
, Seok-Tae JEONG
1
, Joong-Ho KWON
2
and Young-Jin JEONG
3
1
Dept. of Agrofood Resources, NAAS, RDA, Suwon 441-707, Korea.
2
Dept. o
f

Food Science and technology, Kyungpook National University, Daegu 702-701,
Korea.
3
Dept. of Food Science and technology, Keimyung University,
D
aegu
704-701, Korea.
*Corresponding author: yeobio@korea.kr
This study investigated brown rice Makgoelli, a traditional Korean alcoholic
beverage, made with different types of yeast and investigated the quality
characteristics of brown rice vinegar made from these Makgoelli
b
everages.
The alcohol content by yeast was the highest in (B) by recording 14.3% and
the titratable acidity was less than 0.6% in all ranges. When quality
characteristics of agitated and static culture brown rice vinegar using them
were compared, acidity of agitated culture vinegar recorded the highest level
or 6% at 7 day of fermentation (DV) with the initial acidity of 1.0% and
the initial pH of 3.9∼4, and (AV), (CV) and (BV) recorded 5.64, 5.55 and
5.32%, respectively. Comparison of free amino acid of brown rice vinegar
showed that for agitated culture brown rice vinegar the content of total free
amino acid was higher in (BV), (DV), (AV) and (CV) in the order and the
content of essential amino acid was the highest in (BV) by recording over
1,000 ppm. From these results, quality characteristics of brown rice vinegar
were found to be affected by acetic acid fermentation methods rather than
types of yeast. However, as future aging process is expected to change flavor
components and sensory characteristics, studies on various quality factors o
f

vinegar are needed.
Keywords: Brown rice, Yeast, Vinegar, Acetic acid, Agitated and Static
culture
I-46
EIIA
Ntr
Is Related to Oxidative Stress Resistance and Virulence
in Salmonella Typhimurium
Yoonjee CHANG, Jeongjoon CHOI and Sangryeol RYU*
Laboratory of Molecular Food Microbiology, Department of Food and
A
nimal
Biotechnology, Department of Agricultural Biotechnology and Center
f
or
Agricultural Biomaterials, Seoul National University, Seoul 151-921, Korea.
*Corresponding author: yjchang10@snu.ac.kr
It has been shown that expressions of Salmonella pathogenicity island
2 are negatively controlled by Enzyme IIA
Ntr
, a component of the
nitrogen-metabolic phosphotransferase system encoded by the ptsN gene.
To find additional genes regulated by EIIA
Ntr
, a DNA microarray was
performed and sodC gene expression was found to be altered in the absence
of the ptsN gene. Comparing expression of two sodC genes, sodCI and
sodCII, between wild-type and ptsN mutant, significant difference was
found only in the expression of sodCI which is known to be involved
in Salmonella virulence. Analyses of the sodCI transcription and the level
of SodCI protein revealed strong possibility of a post-transcriptional
regulation of sodCI by ptsN because the SodCI production was increased
about 10-fold in the ptsN deletion mutant even though the sodCI
transcription level was not much different between the wild type and the
p
ts
N
mutant. We also found that the hfq gene is associated with regulation
of SodCI expression. Further investigation is required to elucidate the
detailed regulatory mechanism of sodCI by the ptsN and the hfq genes.
Keywords: Salmonella, virulence, sodCI
I-47
Probiotic Characterization of Lactic Acid Bacteria Isolated fro
m

Kimchi
Ji Hye JUNG and Hae Choon CHANG*
Department of Food and Nutrition and Research Center for Kimchi, Chosun
University, Gwangju, 501-759.
*Corresponding author: 5011402@hanmail.net
Lactic acid bacteria (LAB) producing mannitol such as
L
euconostoc
citreum GR1, Pediococcus pentosaceus MP1, Leuconostoc kimchii C2,
Leuconostoc mesenteroides PH12, Leuconostoc kimchii GJ22, and
Leuconostoc mesenteroides DM1 were isolated from kimchi. Properties
of the six strains as a probiotics were examined; hemolysis activity, various
enzyme activities, and acid-artificial gastric juice-bile tolerance. When six
LAB were incubated in the horse blood agar media, hemolysis phenomena
did not observed. In test of API ZYM kit, β-glucuronidase was not
produced by six LAB. P. pentosaceus MP1 showed the highest survival
rate in 0.05M sodium phosphate buffer (pH 2.5) for 2 h 57% and in
artificial gastric juice (pepsin 1,000 units/mL, pH 2.5) for 2 h 96%.
L
eu.
kimchii GJ22 showed 100% survival rate in 0.3% oxgall for 24 h.
L
eu.
citreum GR1 showed 97% survival rate in under 0.3% oxgall for 24 h
after incubation in artificial gastric juice for 2 h. These results suggested
that Leu. citreum GR1, Leu. kimchii GJ22, and P. pentosaceus MP1 should
be used as a good candidate as a probiotic.
Keywords: Probiotic, Lactic Acid Bacteria, Kimchi
I-48
383
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Isolation of Bacillus spp. antagonistic to Bacillus cereus from
Cheonggukjang and Gungjungjang and Culture Condition fo
r

Antibacterial Substance Production
Nam Keun LEE, In-Cheol YEO, Young Jun RYU, Chang-Jun CHA and
Young Tae HAHM*
Dept. of Biotechnology (BK21 program), Chung-Ang University,
A
nseong
456-756, Korea.
*Corresponding author: nkl73@hanmail.net
Bacillus spp. antagonistic to Bacillus cereus were isolated from
Cheonggukjang and Gungjungjang. Strains were selected with high
antibacterial activity. Cell-free supernatant of B. subtilis SC-8 extracted
with methanol was tested for antagonistic activity against food-borne
pathogenic bacteria, Bacillus cereus group bacteria, and major
soybean-fermenting Bacillus spp. Aside from B. cereus group
b
acteria,
inhibitory activity of cell-free extract was not detected against the other
tested bacterial species. The effects of pHs and temperatures on cell
population and antibacterial substance production were determined with
LB broth as basal culture medium. The optimal pH for cell population
and antibacterial substance production was 7.0 (1.87±0.01 at A
600
and
5.30±0.11 mg mL
-1
). In temperature, cell density and antibacterial
substance production were optimal at the range of 30~40

(1.87±
0.01~2.12±0.17 at A
600
) and 37~45

(5.30±0.11~5.93±0.33 mg mL
-1
),
respectively. Based on these results, the effects of carbon sources (glucose,
sucrose, galactose, lactose, and maltose), nitrogen sources (beef extract,
malt extract, peptone, tryptone, yeast extract, and (NH
4
)
2
SO
4
), and trace
elements (CaCl
2
, MgCl
2
, MnSO
4
, CoCl
2
, Cu(C
2
H
3
O
2
)
2
·H
2
O, and
FeSO
4
∙H
2
O) were analyzed.
Keywords: antibacterial substance production, Bacillus cereus group
bacteria, Cheonggukjang and Gungjungjang
I-49
Multiplex PCR for Simultaneous Detection of five Listeria spp.
Jio RYU, Hyungjae LEE and Hae-Yeong KIM*
Institute of Life Sciences &Resources and Department of Food Science
&Biotechnology, Kyung Hee University, Yongin, 446-701, Korea.
*Corresponding author: hykim@khu.ac.kr
Listeria spp. is a facultative intracellular pathogen that can cause serious
illness in susceptible individuals; particularly pregnant women, newborns,
and the elderly people are vulnerable to listeriosis. Therefore, outbreaks
associated with Listeria spp. are major public health concerns in the world.
In this study, a multiplex PCR was developed for rapid and simultaneously
detection of five Listeria spp. including Listeria monocytogenes,
L
.
innocua, L. ivanovii, L. welshimeri, L. seeligeri, and L. grayii. The
multiplex PCR employed one Listeria-specific set and five additional
primer pairs for the five individual Listeria spp: four previously reported
and one newly designed pairs. The multiplex PCR successfully resulted
in five PCR amplicons with different size for the simultaneous detection.
These results suggest that the multiplex PCR developed in this study is
greatly useful for the rapid and reliable detection of Listeria spp. in
contaminated foods or clinical samples as well as epidemiological
investigation of food poisoning outbreaks.
Keywords: multiplex PCR, simultaneous detection, Listeria spp.
I-50
A Paired Starter Culture for Mass Production of Kimchi, Consisting
of Leuconostoc mesenteroides Strain and Leuconostoc citreum
Strain
Uk-Han CHOI
1
, Jeong-Hun KIM
2
, Seung Gi MIN
3
, Byoung Joo SEO
1
,
Jeongheui LIM
1
and Yong-Ha PARK*
1
1
Department of Applied Microbiology and Biotechnology, Yeungnam University.
2
Foodmerce Co., Ltd., Pulmuone Co., Ltd., Seoul.
3
R&D Center for Food
Technology, Pulmuone Co., Ltd., Seoul.
*Corresponding author: joos02@ynu.ac.kr
Use of a suitable starter culture to produce Kimchi improve product
quality and is crucial in the food safety and uniformity of large scale
fermentation and production. In this study, we designed a novel starter
culture system by pairing Leuconostoc mesenteroides YML005 and
Leuconostoc citreum KM20 isolated and selected from dominant strains
of Kimchi fermentation. L. mesenteroides YML005 and L. citreum KM20
were evaluated separately and in combination for growth and organic acid
production in a model Kimchi fermentation during 60 days. The levels
of lactic acid were seen higher in Kimchi fermented with L. mesenteroides
YML005 and higher levels of succinic acid were observed with L. citreum
KM20. Kimchi fermented with the mixed starter culture of
L
.
mesenteroides YML005 and L. citreum KM20 presented the strong
antimicrobial activity as the pathogenic microbes E. coli and Salmonella
were disappeared in three days. A balanced level of organic acids and
better sensory taste were achieved as compared to control or with single
starter culture fermentations.
Keywords: Leuconostoc mesenteroides YML005, Leuconostoc citreum
KM20, Kimchi Starter
I-51
Analysis of the Cultivable Bacterial Communities in Meju and
Doenjang
Gwangsick JUNG and Jong-Hoon LEE*
Department of Food Science and Biotechnlogy, Kyonggi University, Suwon
443-760, Korea.
*Corresponding author: jhl@kyonggi.ac.kr
Cultivable bacterial communities present in meju and doenjang were
analyzed to draw a more concrete overview of bacteria in the fermented
soybean food of Korea. The surface and inside of meju and the paste
of doejang were used as the samples of bacterial analysis and about 55
colonies were purely isolated from each sample. Isolates were
phylogenetically identified by 16S rRNA gene sequence analysis. Small
differences were found in cultivable bacterial communities among samples.
Isolates were belong to 11 species in the 3 genera and 6 species were
not found in the previous studies. Bacillus sp. and Staphylococcus sp.
were 51% and 47% of total isolates, respectively.
B
acillus
methylotrophicus and Staphylococcus succinus were the most populous
species in the genus. Enterococcus durans was the only lactic acid
bacterium isolated in this research.
I-52
384
www.kormb.or.k
r

Anti-Film-Forming-Yeast Activity of Bacillus velezensis Isolate
d

from Korean Traditional Soybean Product.
Mi CHANG, Ji Hye JUNG and Hae Choon CHANG*
Department of Food and Nutrition and Research Center for Kimchi, Chosun
University, Gwangju, 501-759.
*Corresponding author: rose-zang@hanmail.net
Two bacterial strains which showed a growth inhibitory effect against
film-forming yeast, was isolated from Korean traditional soybean product.
The two strains were identified as Bacillus velezensis based on
morphological, biochemical properties, and 16S rRNA sequences
determination. Antifungal activity was assayed using direct method and
spot-on-the lawn test. The isolated two strains showed high antifungal
activity against the various pathogenic molds and yeasts including of
Penicillium roqueforti ATCC 10110, Cladosporium gossypiicola KF-2,
Aspergillus petrakii PF-1, Aspergillus ochraceus PF-2,
I
ssatchenkia
orientalis GY1, Saccharomyces servazzii DY2, and Candida albicans
ATCC 11006.
Keywords: Bacillus velezensis, Antifungal activity, Film-forming yeast
I-53
The Characteristics of Bacteriocin produced by Bacillus subtilis
Isolate
Ji Young LEE, Ah Ra CHO and Dae Ook KANG*
Department of Biochemistry and Health Science, Changwon National University,
Changwon 641-773, Korea.
*Corresponding author: dokang@changwon.ac.kr
A bacteriocin-producing identified as Bacilllus subtilis was isolated
from kimchi. The antibacterial activity was inactivated by proteinase K,
indicating its proteinous nature. In order to purity the bacteriocin, B.
subtilis was grown in 2 L of MRS broth at 37

, 250 rpm for 48 hr.Culture
supernant was recovered by centrifugation at 4

, 6000 rpm for 10 min
and concentrated with 65% ammonium sulfate followed by resuspension
in 50 ml of DW and dialysis 50 mM sodium phosphate, pH 6.0. The
concentrate went through SP-Sepharose chromatography.We examined the
physical and chemical properties of the bacteriocin using concentrated
supernatant. The bacteriocin activity wholly retained up to 60

for an
hour but 50 % of the total activity remained at 80

for an hour. The
bacteriocin was resistant to the pH range from 2.0 to 8.0 and to solvents
such as acetonitrile, isopropanol, methanol, chloroform and acetone up
to 50% concentration. There was no bacteriocin activity after treatment
of the bacteriocin with α-chymotrypsion, trypsin, proteinase K, lipase,
α-amlyse and subtilisin A. The bacteriocin showed the antibacterial activity
against M. luteus IAM 1056, B. megaterium KCTC 1098, B. subtilis KCTC
1023, B. cereus KCTC 1013, L. ivanovii subsp. ivanovii KCTC 3444,
and X. citri KCTC 2499.
Keywords: Antibacterial spectrum, Bacillus subtilis, bacteriocn, pH,
proteinase K, solvent
I-54
Antiyeast Activities of Two Lactobacillus plantarum Strains
Isolated from Kimchi
Eun Ju YANG and Hae Choon CHANG*
Dept. of Food and Nutrition, Chosun University, Gwangju 501-759, Korea.
*Corresponding author: rootage@hanmail.net
One hundred eight lactic acid bacteria isolates were screened for
antiyeast activity against two film-forming yeasts, Issatchenkia orientalis
GY1 and Saccharomyces servazzii DY2. The isolates harboring the
strongest inhibitory activity, NO1 and HD1, were selected for antiyeast
activity. The NO1 and HD1 strains were identified as
L
actobacillus
p
lantarum based on its morphological and biochemical properties, and
16S rRNA sequence determination. The antimicrobial activities of NO1
and HD1 were examined against various species of Gram-positive and
negative bacteria, yeasts, and molds by the dual culture overlay assay
and the spot-on-the lawn test. The antimicrobial activities of the
compounds produced by NO1 and HD1 were found to be stable after
heat (121

for 15 min) and proteolytic enzyme treatment, but they were
unstable over pH 5.0. Their antimicrobial compounds were estimated to
have a low molecular mass (below 3,000 Da).
Keywords: Lactobacillus plantarum, antiyeast activity, kimchi
I-55
Quality Characteristics of Wheat-Rice Flour Takju Using Making
of Rice Nuruk by Rhizopus oryzae CCS01
Kye Man CHO*
1
, Hyeon Kook CHO
2
, Weon Taek SEO
1
, Ju Young LEE
2
,
Dong Ceol LEE
2
and Dong Hyeon KIM
2
1
Department of Food Science, Gyeongnam National University of Science and
Technology, Jinju 660-758, Republic of Korea.
2
Farming Corporation OrumJooga
Winery, Sacheon 664-070, Republic of Korea.
*Corresponding author: kmcho@gntech.ac.kr
This study was carried out for development of the wheat-rice flour takju
using making of rice nuruk (RN) by Rhizopus oryzae CCS01. The levels
of pH, alcohol, and yeast cell number of making of takju by RN were
higher than making of takju by commercial nuruk (CN), in contrast the
contents of acidity, °Brix, lactic acid bacteria (LAB) cell number, and
browning (OD
420nm
) of making of takju by RN were lower than making
of takju by CN. A lower alcohol contents were observed with a higher
concentration of wheat flour, but a higher browning were shown with
a higher concentration of wheat flour. After fermentation at day 7, the
60% wheat flour takju (wheat : rice = 6 : 4) appeared the pH 3.87, 0.09%
acidity, 7.2 °Brix, 13.0% alcohol content, 1.0 × 10
7
cfu LAB/mL, 1.6
× 10
7
cfu yeast/mL, and 0.291 browning. The results suggest that the
making of the new type takju using polishing wheat was possible [This
work was supported by Grant No. 70008597 from the Development o
f

Regional Industry and Technology program of MSK, and partially by the
Korea Sanhak Foundation, Korea].
Keywords: Wheat flour, Takju, Rice nuruk
I-56
385
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Distribution of Virulence Genes in Staphylococcus aureus isolated
from Various Sources
Yangkyun KIM, Dong Hwan LEE, Sook-Young JANG, Mukesh KUMAR,
Shweta MALHOTRA, Kyu Suk JUNG, Jongchul YUN, Sunggi HEU and
Eunjung ROH*
Microbial Safety Division, National Academy of Agricultural Science, RDA,
Suwon 441-707.
*Corresponding author: rosalia51@korea.kr
A total of 125 isolates of Staphylococcus aureus was collected from
food, human, livestock and leafy greens. To study genetic diversity among
the isolates, genes associated with virulence and antibiotics susceptibility
were analyzed using PCR and disk diffusion method. It is learned that
all isolates have coagulase gene but a number of polymorphisms exists
within the virulence related genes. At least one of enterotoxin encoded
genes (SEA, SEB, SEC, SED, and SEE) was detected in 57
(45.6%)isolates. Toxic shock syndrome toxin 1 (TSST-1) gene which is
related with SEC gene was detected in 21 (16.8%) isolates. In accordance
with the agr locus grouping, 37, 69, 10 and 7 isolates were
b
elonging
to agr subgroup I, II, III, and IV, respectively. Especially, agr IV was
found only in strains isolated from livestock.
Keywords: Staphylococcus aureus, enterotoxin, agr
I-57
Association between the Presence of Tetracycline Resistance and
Agg Gene Encoding Conjugative Pheromone-responsive Plasmids
in Enterococcus faecalis from Meat and Fish
Jong-Mi CHOI
1
, Hyo-Sun KWAK
2
, Jae-Won KIM
3
and Gun-Jo WOO*
1
1
Laboratory of Food Safety and Evaluation, Department of Food Bioscience and
Technology, Korea University, Seoul 136-713, Korea.
2
Korea Food and
D
rug
Administration, Cheongwon-gun, Chungcheongbuk-do 363-700,
K
orea.
3
Bioscience Research Center, CJ CheilJedang, Gayang 1-dong, Gangseo-gu,
Seoul 157-200, Korea.
*Corresponding author: visionkorea@korea.ac.kr
The aim of this study was to investigate the correlation between the virulence
genes and tetracycline resistance factors in E. faecalis from food. A total o
f

181 tetracyline resistant (Tc
R
) E. faecalis was isolated from meat, fish in
2003-2006, and 2009. Tc
R
E. faecalis were examined for seven tetracycline
resistance genes [tet(K), tet(L), tet(M), tet(O), tet(S), tet(T) and tet(W)]. The
prevalence of virulence genes was gelE(72.9%), agg(64.5%) and esp(3.8%).
Relatively, the isolates carrying tet(M) with the agg(+) gene were more detected
than the isolates carrying the tet(M) with the agg(-) gene. The finding of their
co-relationship was confirmed by using Chi-square test (P-value>0.05). PFGE
results confirmed that most of Tc
R
E. faecalis harboring agg(+) isolates were
clonally unrelated. The agg gene encoding conjugative
p
heromone-responsive
plasmids is unique to E. faecalis allowing horizontal transfer of antibiotic
resistance and virulence genes. Therefore, the feature of agg gene might
contribute to the emergence of strains with enhanced their ability. Our data
clearly shows that co-transfer of antibiotics resistant genes as well as tet(M)
and the other virulence genes may be activated through plasmid conjugation
by pheromone production among the E. faecalis harboring agg gene
Keywords: Enterococcus faecalis, tetracycline resistance, aggregation
substance
I-58
Partial Properties of Alpha-Galactosidic Activity from Bacillus
sp. LX-1
Jae Koo LEE and Jaiesoon CHO*
Dept. of Animal Sciences and Enviroment, College of Animal Bioscience and
Technology, Konkuk University, Seoul 143-701, Korea.
*Corresponding author: chojs70@konkuk.ac.kr
A bacterial isolate showed extracellular α-galactosidase activity. Based
on 16S rRNA gene sequence analysis, the strain was named Bacillus sp.
LX-1. The optimal activity for the LX-1 a-galactosidase occurred at pH
7.0. The enzyme was optimally active at 40
o
C. The enzyme hydrolyzed
exclusively a-D-galactosides such as p-nitrophenyl-a-galactopyranoside,
melibiose, raffinose and stachyose. It showed no activity against
polysaccharides such as carboxymethylcellulose, xylan, locust bean gum
(galactomannan) and starch. Furthermore, the enzyme was resistant to
some proteases such as trypsin and pronase. 2 mM concentrations of Ag
+
,
Hg
2+
, Cu
2+
, and SDS strongly inhibited the α-galactosidase activity,
whereas the enzyme exhibited no or low inhibition by
b
-mercaptoethanol
and EDTA. The LX-1 a-galactosidase may offer potential for use as an
additive for soybean processing in the food and feed industries.
Keywords: Bacillus sp, alpha-galactosidase, soybean processing
I-59
Identification of Vibrio parahaemolyticus, V. vulnificus and V.
cholera Using Multiplex PCR and Whole Cell Protein Analysis
Chae-Yoon LEE
2
, Hyungjae LEE
1
, Sang-Suk OH
2
and Hae-Yeong KIM*
1
1
Institute of Life Sciences &Resources and Department of Food Science
&Biotechnology, Kyung Hee University, Yongin, 446-701, Korea.
2
Dept. of Food
Science &Engineering, Ewha Womans University, Seoul 120-750, Korea.
*Corresponding author: hykim@khu.ac.kr
Outbreak associated with Vibrio spp. frequently happens in Asia
b
ecause
of the dietary habits of eating raw seafood. There are 12 Vibrio spp.
that are pathogenic to human beings. Among them, Vibrio
p
arahaemolyticus, V. vulnificus and V. cholera are reported to be major
human pathogens in Korea. V. parahaemolyticus and V. cholerae cause
gastroenteritis and V. vulnificus is related to wound infection. In this study,
a multiplex PCR was developed to detect the three Vibrio spp. using
species-specific PCR primers. The multiplex PCR yielded three distinctive
PCR products specific to the individual species. The multiplex PCR was
successfully validated against nine Vibrio spp. including three V.
p
arahaemolyticus, two V. vulnificus and one V. cholera and six other
Vibrio spp. In addition, whole cell protein pattern analysis using
SDS-PAGE was performed to determine phylogenetic difference of 17
Vibrio spp.: three V. parahaemolyticus, two V. vulnificus, one V. cholera
and 11 other Vibrio spp. All the Vibrio spp. showed different whole cell
protein pattern compared with one another. Therefore, these results
suggests that the multiplex PCR together with whole cell protein analysis
may facilitate specific, rapid and simple identification of main Vibrio spp.
involved in foodborne diseases.
Keywords: multiplex PCR, whole cell protein, Vibrio spp.
I-60
386
www.kormb.or.k
r

Characterization of a Novel Gene Involved in Pathogenicity o
f

Pectobacterium carotovorum subsp. carotovorum
Dong Hwan LEE, Eunjung ROH, Sook-young JANG, Yangkyun KIM,
Kyu Suk JUNG, Mukesh KUMAR, Shweta MALHOTRA, Jongchul YUN
and Sunggi HEU*
Microbial Safety Division, National Academy of Agricultural Science, Rural
Development Administration, Suwon, 441-707, Korea.
*Corresponding author: heu@rda.go.kr
Pectobacterium carotovorum subsp. carotovorum is a well known
pathogen causing soft rot disease in a wide range of plants. It also causes
serious spoilage of the vegetables during post harvest storage. They
produce several different plant cell wall degrading enzymes (PCWDE).
Previously we made several mutants that lost pathogenicity on Chinese
cabbage. Among those mutants, one mutant carrying mutation on yheO
homologous gene lost maceration activity on vegetables. That mutant was
not able to produce or secrete PCWDE and was not able to multiply
inside plants. Introduction of isolated clones carrying intact yheO gene
into that mutant had overcome the production of PCWDE and was able
to macerate Chinese cabbage. Microarray analysis showed that mutation
in yheO gene induced the expression of genes in two different operons.
One operon involved in the production and secretion of
b
acteriocin
carotovoricin and the other one is operon related with threonine
dehydratase. We will discuss about the possible role of the yheO gene
product in the production and secretion of PCWDE.
Keywords: Pectobacterium carotovorum subsp. carotovorum, yheO,
pathogenicity
I-61
Evaluation of Potential Probiotic Bacteria
Ji Hun BANG
1
, Hwa Jin SIN
1
, Hye Jung CHOI
1
, Hee Su LEE
1
,
Cheol Soo AHN
2
, Young-Kee JEONG
3
, Dong Wan KIM
4
and
Woo Hong JOO*
1
1
Dept. of Biology Changwon National University, Changwon 641-773,
K
orea.
2
Cho-A Pharm. Co, LTD., Haman-kun, Korea.
3
Dept. of Biotechnology,
D
ong-A
University, Korea.
4
Dept. of Microbiology Changwon National University,
Changwon 641-773, Korea.
*Corresponding author: whjoo@changwon.ac.kr
Ninety-six strains of probiotic bacteria have been obtained from Kimchi
and animal feces. The potential of seven candidate probiotic bacteria was
evaluated in this study. Based on 16S ribosomal DNA sequences analysis,
isolated probiotic bacteria were assigned to three different bacterial genera:
Enterococcus, Lactococcus and Lactobacillus. Among the isolates, seven
candidate probiotic strains were selected based on the safety test, such
as hemolytic activity and liquefaction test. Additionally, they had not
produced β-glucosidase, β- glucuronidase and tryptophanase as harmful
enzymes. Seven strains also survived at pH 2.5 and in 0.3%, 0.6%, 1%
bile salts. They were resistant to antibiotics and adhered well to Caco-2
cells. Furthermore, their antimicrobial activity against pathogenic
b
acteria
was also investigated. These results suggest that seven strains had good
potential for application in functional foods and health-related products.
Keywords: probiotics, Lactobacillus, functional foods
I-62
Characterization of New Antihypertensive Angiotensin
I-Converting Enzyme Inhibitory Peptides from Korea Traditional
Rice Wine
Jong Soo LEE, Min-Gu KANG, In-Tack JANG, Jun-Won LEE,
Hahn-Shik KWAK and Jong-Soo LEE*
Department of Life Science and Genetic Engineering, Paichai University,
D
aejeon
302-735, Republic of Korea.
*Corresponding author: biotech8@pcu.ac.kr
This study describes the characterization of a new angiotensin
I-converting enzyme (ACE) inhibitory peptide from Korea traditional rice
wine. After purification of the ACE inhibitor peptides with ultrafiltration,
Sephadex G-25 column chromatography, successively C
18
and SCX
solid-phase extraction, reverse-phase HPLC and size exculsion chromate
graphy, finally, two types of the purified ACE inhibitors with IC
50
values
of 0.34 mg/mL and 1.23 mg/mL of inhibitory activity were obtained. The
two purified ACE inhibitors (F-1 and F-2) were found that it had novel
two kinds of oligopeptides, showing very little similarity to other ACE
inhibitory peptide sequences. The amino acid sequences of the two purified
oligopeptides were found to be Gln-Phe-Tyr-Ala-Val (F-1) and Ala-Gly-
Pro-Val-Leu-Leu (F-2) and its molecular masses were estimated to
b
e
468.7 Da (F-1) and 357.7 Da (F-2), respectively. They all showed a clear
antihypertensive effect on spontaneously hypertensive rats at a dosage
of 500 mg/kg.
Keywords: Korea traditional rice wine, Angiotensin I-converting enzyme
inhibitory peptide, Antihypertension
I-63
Molecular Characterization of High Level Gentamicin-resistant
Enterococcus faecalis from Chicken Harboring aac(6’)-Ie-
aph(2’’)-Ia gene
Jong-Mi CHOI
1
, Min-Tae KIM
1
, Heat-Nim YOON
1
, Hyun-Wol KANG
1
,
Hyo-Sun KWAK
2
, Jae-Won KIM
3
and Gun-Jo WOO*
1
1
Laboratory of Food Safety and Evaluation, Department of Food Bioscience and
Technology, Korea University, Seoul 136-713, Korea.
2
Korea Food and
D
rug
Administration, Cheongwon-gun, Chungcheongbuk-do 363-700, Korea.
3
Research
Center, CJ CheilJedang, Gayang 1-dong, Gangseo-gu, Seoul 157-200, Korea.
*Corresponding author: visionkorea@korea.ac.kr
Among 240 E. faecalis isolated from chicken between 2003-2006, and 2009,
the high level gentamicin-resistant (HLGR) E. faecalis harboring aac(6’)-
Ie-aph(2’’)-Ia gene strains were characterized by testing various virulence
genes through MLST and PFGE. All seven HLGR E. faecalis isolated from
chicken carried the aac(6')-Ie-aph(2'')-Ia gene (MIC >2,048 μg/mL). Three
strains were resistant to both gentamicin and streptomycin (both MIC >2,048
μg/mL), which carried aac(6')-Ie-aph(2'')-Ia and ant(6)-la genes. Based on
MLST analysis, 3 isolates (23.3%) belonged to ST82 and the remaining isolates
of ST type were ST116 and possible new ST types. Interestingly, ST82 has
been recently reported as amyloid arthropathy caused by potential zoonotic
clones. Furthermore, ST116 has also been described from human clinical
samples. The PFGE patterns of ST82 isolates were similar even though they
were isolated in different years. Our results confirmed that certain ST type
of disease causing E. faecalis is clonally related and widely distributed. Besides,
the finding of HLGR E. faecalis from poultry also might be a risk source
of HLGR E. faecalis infections in human. Therefore, further investigations
are needed to establish whether the poultry isolates are related to human.
Keywords: Enterococcus faecalis, MLST, multilocus sequence typing,
HLGR, high level gentamicin resistance
I-64
387
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Biological Activities of Yogurt Added with Dual Fermentation
Monascus-fermented Chinese Yam Powder
Chun-Pyo JEON
2
, Keun-Hyung LEE
1
, Soon-Young CHO
1
, Il-Joo KIM
1
,
Jung-Bok LEE
3
, Chung-Sig CHOI
4
, Joon-Geol LEE
2
and Gi-Seok KWON*
1
1
School of Bioresource Sciences, Andong National University, Andong 760-749,
Korea.
2
Dept. of Medicine Quality Analysis, Andong science college,
A
ndong
760-709, Korea.
3
Dept. of Optometry, Kundong University, Andong 760-833,
Korea.
4
Bio Industry Institute, HansBio Co.,Ltd. Andong 760-883, Korea.
*Corresponding author: gskwon@andong.ac.kr
Yogurt is one of the most popular fermented foods and has
b
een
traditionallyconsumed for a long time in many countries. Yogurt products,
in addition to providing both energy and nutrients, are an excellent source
of bioactive peptides. Among various bioactive peptides, the
antihypertensive peptides or angiotensin converting enzyme inhibitors are
the most widely studied.In this study, show that yogurt base was prepared
from whole milk, skim milk supplemented with 0.1-2.0% Monascus-
Fermented Chinese Yam(MFCY) powder and fermented L. acidophilus
KCTC3171, L. brevis HLJ59 and L. plantarum KCTC3107 at 34

for
12h. Functional characteristics of the prepared yogurt were evaluated for
acid production(pH and titratable acidity), number of viable cells, DPPH
radical scavenging activity, total polyphenol contents, reducing power and
ACE inhibitory activity. Also we were investigated GABA (γ
-aminobutyric acid) contents of yogurt added with monascus-fermented
chinese yam powder.

This study was supported by Technology
Development Program for Agriculture and Forestry, Ministry of
Agriculture and Forestry, Republic of korea(2009-0164)

Keywords: GABA, Monascus-fermented Chinese Yam, Yogurt
I-65
Isolation and Characterization of GRAS Poly-γ-glutamic Acid
Producers from the Fermented Korean Foods, Cheongkukjang,
Doenjang, Toha-jeot, and Kimchi
Dong Hwan CHOI
1
, Dan Bee CHOI
3
, Mi Sun KWAK
1
and
Moon Hee SUNG*
1,2
1
Dept. of Advanced Fermentation Fusion Science &Technology,
K
ookmin
University, Korea.
2
BioLeaders Corporation, Daejeon, Korea.
3
Dept. Bio
&Nanochemistry, Kookmin University, Seoul, Korea.
*Corresponding author: smoonhee@kookmin.ac.kr
Poly-γ-glutamic acid (γ-PGA) is an anionic homo-polyamide in which
D- and L-glutamate units are connected by amide linkages between α
-amino and γ-carboxylic groups. The characteristics and properties of γ
-PGA vary depending on its molecular weight and D/L-glutamic acid ratio.
γ-PGA has great potential as a biodegradable polymer in a broad range
of industrial fields such as food, cosmetics, medicine, and water treatment.
In order to isolate γ-PGA producers that are suitable for specific
applications, we screened the various (GRAS) γ-PGA producers recognized
as safe from the following fermented Korean foods: cheongkukjang,
doenjang, toha-jeot (salt-fermented toha shrimp), and kimchi. We isolated
four strains that could grow and form a highly mucous colony on a γ-PGA
production medium. The isolated strains were examined for colony shapes,
physiological properties, and cell morphologies. The isolated strains were
gram-positive and showed endospores at a late-growth stage under aerobic
conditions. The 16s ribosomal RNA sequence of the isolated strains
revealed the highest homology score with the Bacillus species. [This work
was supported by the Seoul R&BD Program (10580) and Top Brand
Project grant from Korea Research Council of Fundamental Science
&Technology (KGM3110912).]
Keywords: gamma-PGA, PGA, g-PGA
I-66
Isolation and Characterization of Two Staphylococcus aureus
Phages with a Great Potential to be Used as an Antimicrobial
Agent
Bit-Na SONG, Jun Hee JO, Nadeeka BANDARA and Kwang-Pyo KIM*
Department of Food Science and Technology, College of Agriculture and Life
Sciences, Chonbuk National University.
*Corresponding author: kpkim@jbnu.ac.kr
Staphylococcus aureus is an opportunistic pathogen that causes food
poisoning. Spread of multiple antibiotic resistances in this species is a
serious concern. In this study, we isolated two bacteriophages, SAP 1-1
and SAP 2-1, and characterized, in order to evaluate their potential to
be used as an antimicrobial agent. Out of 21 samples, SAP 1-1 and SAP
2-1 were isolated from sewage and soil sample, respectively. Multiple
single plaque isolation, large scale preparation using liquid culture, PEG
precipitation and CsCl-gradient ultracentrifugation were followed for large
scale purification of phages. TEM and restriction enzyme digestion pattern
analysis revealed that two phages belong to Myoviridae family with head
and tail dimensions of 100±5nm and 200±5nm, respectively. Burst sizes
were determined to be 22 and 38, for SAP 1-1 and SAP 2-1, respectively.
Extended host range analysis of SAP1-1 using 368 strains revealed that
97% of the isolates were sensitive to phage application in dotting assay
and in plating method. No other bacterial species were lysed by either
phage. In addition, two phages were able to inhibit bacterial growth in
liquid culture. Our findings suggest that two phages have a great potential
to be used as S. aureus specific antimicrobial agent.
Keywords: Stapylococcus aureus, Bacteriophage, Broad host range
I-67
Purification of Lipopeptides Produced by Bacillus polyfermenticus
CJ6 Isolated from Meju
Eun Ju YANG and Hae Choon CHANG*
Dept. of Food and Nutrition, Chosun university, Gwangju 501-759, Korea.
*Corresponding author: rootage@hanmail.net
The antifungal compounds produced by Bacillus polyfermenticus CJ6
were purified and characterized. From the culture broth of
B
.
p
olyfermenticus CJ6, antifungal compounds were purified using C18
Sep-Pak cartridge, prep-HPLC, and reverse-phase HPLC. The molecular
masses of purified antifungal compounds were estimated by mass
spectrometry (MS) analysis. The masses of the four compounds, which
were determined to be 994.8, 1016.8, 1044.5, and 1058.6 m/z, were
revealed that these compounds belong to the surfactin family. In addition,
the masses of the six compounds, which were determined to be 1435.8,
1449.8, 1463.9, 1477.9, 1491.9, and 1505.9 m/z, were revealed that these
compounds belong to the fengycin family. This result represented that
B. polyfermenticus CJ6 produced two antifungal lipopeptides: surfactin
and fengycin families.
Keywords: Bacillus polyfermenticus, surfactin, fengycin
I-68
388
www.kormb.or.k
r

Cloning and Expression of Cinnamoylesterase from Lactobacillus
acidophilus NCFM Isolated from Human Feces
Jong HUI and Sang-Ho BAIK*
Department of Food Science and Human Nutrition, and Research Institute o
f

Human Ecology, Chonbuk National University, Jeonju, Jeonbuk 561-756, Korea.
*Corresponding author: baiksh@chonbuk.ac.kr
One of hydroxycinnamic acids, chlorogenic acid is well known to
possess high level of antioxidant activity and revealed that a low dosage
of hydroxycinnamic acids stimulates insulin production and alleviates
symtoms caused by diabetes. In our previous study, we were able to
successfully isolate five strains from approximately each 200 lactic acid
bacteria from human feces of diabetes and non-diabetes. Among them,
we found that most high conversion ratio from chlorogenic and to caffeic
acid was observed at L. acidophilus NCFM strain. Thus we examined
the properties of this strain concerning on pH, temperature and culture
time for CE production. Moreover, we was able to obtain the gene of
CE (741bp) by PCR method and cloned in pET 28a expression vector
with a His6-tagged protein sequence. The clone transformed in E. coli
BL21(DE3) showed high level expression on SDS-PAGE at 1.0 mM IPTG
at 37
o
C for 16 hr. We are currently trying to purity the CE by FPLC
chromatography.
I-69
Gene Expression Patterns in the Planktonic and Biofilm Cells
of Multiple Antibiotic-Resistant Foodborne Pathogens
Ju-Hee AHN
1
, Xinlong HE
1
, Yunyun ZOU
1
, Jingyu GOU
1
and Hua XU*
1,2
1
Division of Biomaterials Engineering, Kangwon National University, Gangwon
200-701, Korea.
2
Lab. of Maricultural Organism Disease Control and
M
olecular
Pathology, Yellow Sea Fisheries Research Institute, China.
*Corresponding author: juheeahn@kangwon.ac.kr
Over the last decades, the prevalence of antibiotic-resistant
b
acterial
infections has been rapidly increased because of the repeated and
prolonged use of antibiotics, leading to a serious health problem
worldwide. Therefore, understanding the molecular properties of strains
being antibiotic- resistant is a vital to succumb to diseases associated with
antibiotic-resistant pathogens. This study was designed to evaluate gene
expression patterns of the planktonic and biofilm cells of foodborne
pathogens in trypticase soy broth (TSB) adjusted to pH 5.5 and pH 7.3.
The planktonic and biofilm cells of multiple antibiotic-resistant S. aureus
(S. aureus
R
) and S. Typhimurium were more resistant to b-lactams than
those of antibiotic- sensitive S. aureus (S. aureus
S
) and S. Typhimurium
at pH 5.5 and pH 7.3. The relative gene expression levels of norB, norC,
and mdeA genes were increased by 7.0-fold, 4.7-fold, and 4.6-fold,
respectively, in the biofilm cells of S. aureus
S
grown at pH 7.3, while
norB, norC, mdeA, sec, seg, sei, sel, sem, sen, and seo genes were
up-regulated in the biofilm cells of S. aureus
R
. This study provides useful
information for understanding gene expression patterns in the planktonic
and biofilm cells of antibiotic-resistance pathogens exposed to acidic
stress.
Keywords: antibiotic resistance, biofilm, Staphylococcus aureus
I-70
Improvement in Quality of Makgoelli Prepared using Various
Nuruk
Soo-Hwan YEO*
1
, Joo-Yeon KIM
1
, Ji-Ho CHOI
1
, Chang-Ho BAEK
1
,
Han-Seok CHOI
1
, Seok-Tae JEONG
1
and Young-Jin JEONG
2
1
Dept. of Agrofood Resources, NAAS, RDA, Suwon 441-707, Korea.
2
Dept. o
f

Food Science and technology, Keimyung University, Daegu 704-701, Korea.
*Corresponding author: yeobio@korea.kr
This study evaluates quality of nuruk, which is a source material of
Makgoelli, a traditional Korean alcoholic beverage. The nuruk samples
were collected in the Daegu and Gyeongbuk provinces and we investigated
the fermentation characteristics of Makgoelli made of it. The 7 types o
f

nuruk were examined and their pH and titratable acidity were 5.4-5.9
and around 0.1%, respectively. Saccharifying activity was high in D, F,
G, A, and E nuruk by recording over 300 mg%. When quality
characteristics of Makgoelli made of each type of nuruk were compared,
alcohol content was the highest in G nuruk by recording 19% and titratable
acidity was 0.44-0.86% in all samples. The total organic acid content
was the highest in B nuruk at about 4,000 mg% and it was 2,000 mg%
and around 1,000 mg% in A, E, F and G nuruk and C and D nuruk,
respectively. Sensory preference of subjects in their 20s was high overall
in G and C nuruk and that of those in their 40s was high in F and C
nuruk. From all of these results, the types of nuruk largely affected quality
and components of Makgoelli and an appropriate method to consider useful
purpose is needed.
Keywords: Nuruk, Makgoelli, Alcohol fermentation, Organic acid, Sensory
test
I-71
White Rice Fermented by Clostridium butyricum IDCC 9207
Having Antibacterial and Immunostimulatory Activity
Seung-Hun LEE, Seong-Beom KIM, Jae-Hoon KANG and
Dae-Jung KANG*
Bioprocess engineering team, Research laboratories, ILDONG pharmaceutical
Co., Ltd., Hwaseong 445-170, Korea.
*Corresponding author: djkang@ildong.com
The antagonistic activities against animal enteropathogenic
b
acteria
were investigated with 444 natural substances fermented by various
probiotics. We selected a white rice product fermented by Clostridium
butyricum IDCC 9207 with a high growth inhibition of Salmonella
typhimurium KCTC 2054 and Escherichia coli O157 : H7. Also, a white
rice product was shown to suppress 8 pathogenic bacteria among 21
pathogenic bacteria. In a mouse model of salmonella infection, mixture
group composed of the white rice product and C. butyricum IDCC 9207
cells significantly inhibited the growth of salmonella, while in the control
group salmonella increased. And mixture group was found to increase
the secretory immunoglobulin A(sIgA) level in the feces of
salmonella-infected mice. The results obtained in this study suggest that
mixture of white rice product and C. butyricum IDCC 9207 cells may
be a good feed supplement for livestock.
Keywords: Clostridium butyricum IDCC 9207, Antibacterial activity,
Immunostimulatory activity
I-72
389
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Hydrolysis of Biologically-Relevant Pytate by the Bacillus Phytase
Inkyung PARK and Jaiesoon CHO*
Dept. of Animal Sciences and Environment, Konkuk University, Seoul 143-701,
Korea.
*Corresponding author: chojs70@konkuk.ac.kr
The bacterial isolate, derived from soil samples near cattle farm
displayed extracellular phytase activity. Based on the 16S rRNA sequence
analysis, the strain was named Bacillus sp. T4. An extracellular phytase
from Bacillus sp. T4 was partially purified by ammonium sulfate (80%
saturation) in the present of CaCl
2
(at a concentration of 2.0 mM). Its
optimum pH and temperature for phytase activity were 6.0 and 40

,
respectively. Calcium ion (at a concentration of 5.0 mM) has a stabilizing
effect on the enzyme against thermal denaturation. As for substrate
specificity, it was higher specific for pentamagnesium salt of phytate
(Mg-InsP
6
) than dodecasodium salt of phytate (Na-InsP
6
)

or adenosine
5’-monophosphate (AMP) and had little or no activity on other phosphate
esters. Its activity was remarkably inhibited by EDTA and moderately
inhibited by metal ions such as Cu
2+
, Mn
2+
, Ba
2+
and Zn
2+
ions. In this
study, we first report on general catalytic properties of the phytase
produced by Bacillus sp. T4 using physiologically relevant substrate,
Mg-InsP
6
in comparison to Na-InsP
6
.
Keywords: Mg-InsP6, phytase, Bacillus sp. T4
I-73
Occurrence of Mutant Strain of Bacillus subtilis MJP1 and Its
Characteristics
Eun Ju YANG and Hae Choon CHANG*
Dept. of Food and Nutrition, Chosun University, Gwangju 501-759, Korea.
*Corresponding author: rootage@hanmail.net
Bacillus subtilis MJP1, which was isolated from meju, had strong
antibacterial and antifungal activities. We found out a mutant strain o
f

B. subtilis MJP1 through repetitive subcultures. The colony morphology
of the mutant was different from MJP1 colony, but the sugar metabolism
of the mutant were same as that of MJP1. The occurrence of mutation
rate from MJP1 to the mutant was measured following the MJP1
subculturing for 11 days at 37

in LB medium. The first mutant was
appeared after 72 h cultivation, and 100% of cells were turned out the
mutant at the tenth day. The maximum growth and the antimicrobial
activity of the mutant appeared later than those of MJP1. The antibacterial
activity of the mutant was the same as that of MJP1, but the antifungal
activity of the mutant showed lower (25%) than that of MJP1. The
antibacterial compound(s) of the mutant was more sensitive to heat, pH,
and enzyme treatment than that of MJP1, but the antifungal compounds
of MJP1 and the mutant were stable under the same treatments.
Keywords: Bacillus subtilis, mutant, antimicrobial activity
I-74
Comparison of Antimicrobial Activities of 5 Selected Wheat
Extracts
Eun-Ji CHOI
1
, Sung-Hoon JO
1
, Eun-Hye KA
1
, Hak-Sung LEE
2
,
Hae-Dong JANG
1
and Young-In KWON*
1
1
Department of Food and Nutrition, Hannam University, Daejeon,
K
OREA.
2
Research Institute, Bioprogen Co. Ltd., Daejeon 306-230, KOREA.
*Corresponding author: chldmswl2427@naver.com
Natural antimicrobials have been developed to cure bacterial food-borne
illnesses and to control the increasing bacterial resistance to antibiotics
currently used in therapeutics. In this way, antimicrobial research with
natural products is a new field and there is an increased need for natural
preservatives in food, beverages, cosmetics, and food packing. The
antibacterial activities of 5 selected wheat seeds against the food-borne
pathogens S. aureus, E. coli, S. typhimurium, B. cereus and L. mono-
cytogenes were investigated. A major bioactive compound 2,6-dimethoxy-
1,4-benzoquineno (DMBQ) in extracts of 5 selected wheats (JK;Jokyoung,
KK;Keumkangmil, UR;Urimil, WW;Winter wheat, DNS;Dark nourthern
spring wheat) by high-performance liquid chromatography (HPLC). WW
and WR were the most highly inhibitory to S. aureus. WW and WR
which had the highest DMBQ content showed significant antibacterial
activity; the most sensitive organism was S.aureus with an MIC (WW;
IC
50
0.50 mg/ml and IC
50
WR; 1.25 mg/ml). Wheat, a by-product generated
in large quantities by the flour milling industry, could thus be utilized
as a source of the antimicrobial agent. Results suggested that WW has
high antimicrobial and can be used as food preservatives for controlling
food-borne pathogens.
Keywords: Antimicrobial, Wheat
I-75
Genetic Characterization of Podoviridae-Bacteriophages
Infecting Pectobacterium carotovorum subsp. carotovorum
Shweta MALHOTRA, Yangkyun KIM, Dong Hwan LEE,
Sook-Young JANG, Mukesh KUMAR, Kyu Suk JUNG, Eunjung ROH,
Jongchul YUN, Sunggi HEU and Sunggi HEU*
Microbial Safety Division, National Academy of Agricultural Science, RDA,
Suwon 441-707.
*Corresponding author: heu@rda.go.kr
Pectobacterium carotovorum subsp. carotovorum is a plant pathogen
and was earlier classified as Erwinia carotovora subsp. carotovora. It
infects plants and causes soft rot disease and stem rot disease in several
crops such as Chinese cabbage, potato, and tomato. Here, we collected
soil samples from several areas (where Chinese cabbage was being grown)
such as, Pyeongchang, Gochang, Muan, Haenam, Taebaek, and Jeju Island.
A total of 161 Pectobacterium carotovorum subsp. carotovorum
bacteriophages were isolated from the soil. All the phages were observed
under the electron microscope, and were found to be tailed and placed
in the order Caudovirales which includes three families (Myoviridae,
Siphoviridae and Podoviridae). From these, Podoviridae phages were
characterized in depth. The host range analysis and RFLP of Podoviridae
phages revealed the occurrence of several different genetic types of
Podoviridae-phages infecting Pectobacterium carotovorum subsp.
carotovorum in Korea. Four Podoviridae Pectobacterium phages, PPP1,
H2-1, T10-1, and G8-1, were sequenced and analyzed. Results suggested
that the reorganization of genes may be related with the host range o
f

phages.
Keywords: Pectobacterium, bacteriophage, Podoviridae
I-76
390
www.kormb.or.k
r

Derivatives of Monascus Pigment Reducing the Body Weight
Gain and Cholesterol and Triglyceride Contents in Mice
Deokyeong CHOE, Jong Hoon KIM, Sung Hun YOUN and Chul Soo SHIN*
Dept. of Biotechnology, College of Life Science and Biotechnology, Yonsei
University, Seoul 120-749, Korea.
*Corresponding author: csshin@yonsei.ac.kr
The derivatives of Monascus pigment, which are effective for reduction
of mice body weight gain and lowering of cholesterol and triglyceride
contents in mice serum and liver, were produced by Monascus
fermentation. L-Trp or L-Lue-OEt derivatives were ultimately selected.
In order to investigate anti-obesity effects, high fat diets (HFDs)
supplemented with L-Trp derivative or L-Lue-OEt were fed to mice
groups. Compared to the HFD group, the average body weight gain and
intra-peritoneal adipose tissues (IPAT) weights of four derivatives-
supplemented HFD groups were decreased by 13.6-50.9% and 16.7-30.5%,
respectively. The serum total cholesterol and triglyceride levels of mice
were reduced by 9.7-14.4% and 12.5-17.2%, respectively. This suggests
that the two derivatives of monascus pigment can be developed into a
functional food ingredient, which has anti-obesity effects and an advantage
being a GRAS (generally recognized as safe) compound.
Keywords: Monascus pigment, anti-obesity
I-77
Screening of Useful Fungi for Brewing from Nuruk in Gyeongsang
area
SeongYeol BAEK, Hye Ju YUN, Hye Sun CHOI and Soo-Hwan YEO*
Fermentation &Food Processing Division, Department of Agro-food Resource,
NAAS, RDA, Suwon 441-853, Korea.
*Corresponding author: yeobio@korea.kr
Studies on standardization and quality upgrade of nuruk which is a
basic component in brewing are required to increase the quality level
of Korean traditional rice wines and to develop the technology for practical
use of it. It is important to isolate best strains, to improve the properties
and effectively preserve them for brewing industry. In this study, 22
traditional and commercial nuruk samples were obtained from the
commercial markets and farm located in Gyeongsang areas in Korea. 105
fungal strains were isolated from the samples and then screened for enzyme
activity. The active strains were identified based on the morphological
characteristics and ITS sequence analysis. Out of 105 strains, 5 strains
showed high enzyme activity. Our results showed that the active strains
maybe used as microbial sources for nuruk starter with good quality in
brewing.
Keywords: Nuruk, fungi, enzyme activity
I-78
Indentification and Characterization of Erythromycin and
Tetracycline Resistance in Enterococcus faecium
Byoung-Wook KIM
1
, Haet-Nim YOON
1
, Min-Tae KIM
1
, Hyun-Wol
KANG
1
, Jae-Won KIM
2
, Hyo-Sun KWAK
3
and Gun-Jo WOO*
1
1
Laboratory of Food Safety and Evaluation, Department of Food Bioscience and
Technology, Korea University, Seoul 136-713, Korea.
2
Bioscience Research
Center, CJ CheilJedang, Seoul 157-200, Korea.
3
Korea Food and
D
rug
Administration, Cheongwon-gun, Chungcheongbuk-do 363-700, Korea.
*Corresponding author: visionkorea@korea.ac.kr
Enterococci are frequently found in the gastrointestinal tract of human
and animal and known as opportunistic pathogen. Especially antimicrobial
resistant Enterococcus faecium and E. faecalis are considered one of the
most important causative agents. Tetracyclines are frequently used in
food-producing animal raising-farm and used to treat a large number o
f

bacterial infections. In this study, we investigated prevalence of
erythromycin- and tetracycline resistance(E
R
and Tc
R
) in meat-borne E.
f
aecium that collected during 2003-2006 and 2009. Antimicrobial
susceptibility test was performed by disk diffusion and minimum inhibitory
concentration, in accordance with Clinical Laboratory Standards Institute
guidelines. E
R
and Tc
R
E. faecium were tested for the presence of erm(B),
tet(L), tet(M), tet(O), tet(K) and tet(S) genes by PCR and sequencing
analysis. In total of 123 E. faecium, 110 isolates showed resistance (n=65)
or intermediate resistance (n=45) to erythromycin. Of these isolates, 15
isolates possessed only erm(B) gene. Forty one isolates were shown to
be resistant to tetracycline. The tet(L) gene was most frequently detected
among the tetracycline resistance genes. This study shows that E
R
and
Tc
R
E. faecium is potential risk of infection to consumers through food
chain.
Keywords: antimicrobial resistance, Enterococcus faecium, tetracycline
I-79
Optimal Production of Enterocin MK3 from Enterococcus faecium
MK3
Gi-Seong MOON* and Kyung-Sook KIM
Dept. of Biotechnology, Chungju National University, Jeungpyeong 368-701,
Korea.
*Corresponding author: gsmoon@cjnu.ac.kr
The optimal condition for the production of enterocin MK3 from
Enterococcus faecium MK3 was investigated. Several parameters such as
medium, temperature, pH, and oxygen were evaluated for the optimal
condition using a jar fermenter (Capacity: 3 L, working volume 1 L).
At intervals, 0, 12, 24, 48 h, test samples were taken and viable cell
counts, pH, and bacteriocin activity expressed as arbitrary unit (AU)/mL
were measured. MRS broth was chosen as a optimal medium in which
the bacteriocin activity reached 240 AU/mL at 24 h and 25

as a optimal
temperature in MRS broth where the bacteriocin activity reached 480
AU/mL at 48 h. The optimal pH for the production of enterocin MK3
was shown to 6.0 in MRS broth at 25

where the bacteriocin activity
reached 1,920 AU/mL at 24 h. The pH 7.0 also showed the highest
bacteriocin activity at 12 h but the activity was significantly reduced after
that time. Air condition (aerobic or anaerobic) had not significant effect
on the production of enterocin MK3. Enterocin MK3 optimally produced
was precipitated with ammonium sulfate of 50% saturation, dialyzed, and
freeze-dried. The lyophilizate was diluted with ultrapure water and run
on an SDS-PAGE gel with tricine buffer system where molecular mass
of enterocin MK3 was shown to around 6 kDa.
Keywords: enterocin MK3, Enterococcus faecium MK3, optimal production
I-80
391
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Physiological and Molecular Properties of Antibiotic-sensitive
and Antibiotic-resistant Salmonella Typhimurium under
Simulated Gastrointestinal Conditions
Ju-Hee AHN, Yunyun ZOU, JIngyu GOU, Damao WANG and Xinlong HE*
Department of Biomaterials Engineering, Kangwon National University,
Chuncheon 200-701, Korea.
*Corresponding author: juheeahn@kangwon.ac.kr
The objective of this study was to assess the viability and gene
expression patterns of antibiotic-resistant Salmonella Typhimurium in
simulated gastrointestinal conditions. The transit tolerance and relative
expression of acrA, acrB, tolC, stn, hilA, and ompD were observed in
antibiotic-sensitive S. Typhimurium (ASST) and antibiotic-resistant S.
Typhimurium (ARST) exposed to simulated gastric juices (pHs 2.0, 3.0,
and 5.0) for 1 or 4 h, followed by small intestinal juices (0.1% and 0.5%
bile salts) for 2 h. The reductions in the numbers of ASST exposed to
simulated gastrointestinal juices were not significantly different from those
of ARST. The relative expression of acrA, acrB, tolC, stn, hilA, and ompD
in the ARST were up-regulated after exposure to simulated gastrointestinal
juices. The expression of AcrAB-TolC efflux system in ARST was highly
correlated with the expression of stn and hilA encoding virulence factor
and regulator. The cross-protective effect was observed in ARST against
the gastric acid and bile salts. This study provides useful information for
assessing the gastrointestinal transit tolerance and virulence potential o
f

antibiotic-resistant pathogens.
Keywords: Antibiotic resistance, gastrointestinal condition, Salmonella
I-81
Effect of Fermented Sea Tangle on the Alcohol Dehydrogenase
and Acetaldehyde Dehydrogenase in Saccharomyces cerevisiae
Hee Young AHN
2
, Su Jin HEO
2
, Jae Hong LEE
2
, Min Jeong KANG
2
,
Jae Young CHA
3
and Young Su CHO*
1
1
Department of Biotechnology, Dong-A University, Busan 604-714,
K
orea.
2
Department of Medical Biosciences, Graduate School, Dong-A University, Busan
604-714, Korea.
3
1Technical Research Institute, Daesun Distilling Co., Ltd. Busan
619-951, Republic of Korea.
*Corresponding author: an0202@hanmail.net
Sea tangle, a kind of brown seaweed, was fermented with
L
actobacillus
brevis BJ-20. Gamma-aminobutyric acid (GABA) content in fermented
sea tangle (FST) was 5.56% (w/w) and GABA in total free amino acid
of FST was 49.5%. Effect of FST on the enzyme activities and mRNA
protein expression of alcohol dehydrogenase (ADH) and acetaldehyde
dehydrogenase (ALDH) involved in alcohol metabolism in Saccharomyces
cerevisiae was investigated. Yeast was cultured in YPD medium
supplemented with different concentrations of FST powder (0, 0.4, 0.8
and 1.0% w/v) for 18 h. FST had no cytotoxic effect on the yeast growth.
The highest activities and protein expressions of ADH and ALDH from
the cell-free extracts of S. cerevisiae were evident with the 0.4% and
0.8% (w/v) FST-supplemented concentrations, respectively. The highest
concentrations of GABA as well as minerals (Zn, Ca, and Mg) were found
in the cell-free extracts of S. cerevisiae cultured in medium supplemented
with 0.4% (w/v) FST. The levels of GABA, Zn, Ca, and Mg in S.
cerevisiae were strongly correlated with the enzyme activities of ADH
and ALDH in yeast. These results indicate that FST can enhance the
enzyme activities and protein expression of ADH and ALDH in S.
cerevisiae.
Keywords: sea tangle, Saccharomyces cerevisiae, GABA
I-82
Isolation and Characterization of Bacillus cereus Bacteriophage
B4 and its Lytic Enzyme
Bokyung SON, Jeong-A LIM, Hakdong SHIN and Sangryeol RYU*
Department of Agricultural Biotechnology and Center for
A
gricultural
Biomaterials, Seoul National University, Seoul 151-921, Korea.
*Corresponding author: sangryu@snu.ac.kr
Bacillus cereus is a spore-forming food-borne pathogen causing emetic
or diarrheal types of food poisonings. Bacteriophages or their specific
lytic enzymes (endolysin) have been revisited as a biocontrol agent for
eliminating undesirable organisms without affecting other microflora. We
newly isolated eleven bacteriophages showing lytic activity against
B
.
cereus. Among these phages, B4 phage had the most effective inhibition
activity against B. cereus NRRL B-569 and was selected for further study.
B4 phage contains 162,586 bp double-stranded DNA genome with 287
putative ORFs belonging to Myoviridae family. Bioinformatic analysis
of B4 genome revealed a putative lytic protein, B4_ORF99, which had
high homology with L-alanyl-D-glutamate endopeptidase of Listeria phage
A006. The B4_ORF99 gene was cloned, expressed in Escherichia coli,
purified, and their bacteriolytic activity was demonstrated. The optimum
pH and temperature of this enzyme was pH 8-10 and 4-55

, respectively.
The enzyme showed strong lytic activity against B. cereus, B.
s
ubtilis
and L. monocytogenes but didn’t affect other bacteria. These results
suggest that B4_ORF99 might be a good candidate as a new
b
iocontrol
agent.
Keywords: Bacillus cereus, Bacteriophage, Endolysin
I-83
Inhibitory effects of Lactobacillus curvatus HY7601 and
Lactobacillus plantarum KY1032 (LAB) on Adipose Tissue in
Diet-induced Obese C57BL/6J Mice
Do-Young PARK*
1
, Young-Tae AHN
1
, Kil-Sun MYOUNG
1
,
Se-Hoon PARK
1
, Chul-Sung HUH
1
, Sae-Rom YOO
2
and
Myung-Sook CHOI
2
1
Korea Yakult Co., Ltd., Yongin 446-901, Korea.
2
Depart. of Food Science and
Nutrition, Kyungpook National University, Daegu 702-701, Korea.
*Corresponding author: ehdud@re.yakult.co.kr
The aim of this study is to evaluate the effects of Lactobacillus curvatus
HY7601 and Lactobacillus plantarum KY1032 (LAB) on body weight gain,
fat accumulation, and several metabolic parameters in diet-induced obese (DIO)
C57BL/6J mice. Moreover, the enzyme activities related to hepatic lipogenesis
were determined. Final body weight and body weight gain were higher in
high fat diet (HFD) fed mice than in HFD+LAB fed mice after 10 weeks.
Food intake and food efficiency ratio were similar between HFD and
HFD+LAB groups. And the total weight of adipose tissues was higher in HFD
fed mice than in HFD+LAB fed mice. Also the retroperitoneal, mesenteric,
and subcutaneous adipose tissue masses were lower in HFD+LAB fed mice
than in HFD fed mice. The HFD-induced hypercholesterolemia was
significantly improved by feeding LAB. The enlargement of the liver and the
accumulations of cholesterol and triglyceride in the liver of the mice fed with
HFD were ameliorated in mice fed with HFD+LAB. The fatty acid synthase
and malic enzyme activities were lower in HFD+LAB fed mice than in HFD-fed
mice. These findings suggest that Lactobacillus curvatus HY7601 and
Lactobacillus plantarum KY1032 can ameliorate HFD-induced obesity,
probably by modulating hepatic fatty acid biosynthesis.
Keywords: Lactobacillus curvatus HY7601, Lactobacillus plantarum
KY1032, Diet-induced obese mice
I-84
392
www.kormb.or.k
r

Changes of the Enzyme Activities of Doenjang Prepared with
Various Soybean Cultivars
Keum Ok KIM, Dong Jun SIM and Yong Suk KIM*
Department of Food Science &Technology, Chonbuk National University,
J
eonju,
Jeonbuk 561-756, Korea.
*Corresponding author: kimys08@jbnu.ac.kr
In order to select the most ideal soybean cultivars for processing
Doenjang, enzyme activities of Doenjang prepared with 11 soybean
cultivars were investigated during aging for 60 days at an interval o
f

15 days. Acidic protease activities were ranged from 0.235 (Danbaek)
to 0.422 (Daewon) unit/mL at the initial stage and were slightly increased
to the range of 0.329 (Saeol) ~ 0.496 (Milyang192) unit/mL after 60 days
of aging. Neutral protease activities were changed from 0.331
(Milyang206) ~ 0.481 (Milyang192) unit/mL at the initial stage to 0.261
(Jinpum2) ~ 0.590 (Daewon) unit/mL after 60 days of aging. α-Amylase
activities were widely ranged from 0.010 (Danbaek) to 2.932 (Milyang192)
unit/mL during aging. β-Amylase activities were changed from 80.500
(Danbaek) ~ 138.000 (Milyanag192) unit/mL at the initial stage to 76.333
(PI200508) ~ 152.167 (Milyang192) unit/mL after 60 days of aging. To
sum up, protease activities of Doenjang prepared with Milyang192,
Karikei434, N98445A, Daewon, and Taekwang soybeans were higher than
those of others. Amylase activities of Doenjang prepared with
M
ilyang192
soybean was the highest during aging. From these results, we estimate
that Milyang192 soybean was the most ideal soybean cultivar for
processing Doenjang.
I-85
In Vitro Functional Analysis of Traditional Soybean-Fermented
Royal Court Soy Sauce, Gungjungjang
Nam Keun LEE, In-Cheol YEO, Young Jun RYU and Young Tae HAHM*
Dept. of Biotechnology (BK21 program), Chung-Ang University,
A
nseong
456-756, Korea.
*Corresponding author: nkl73@hanmail.net
Gungjungjang had been used for the royal families. Types of soy sauce
in Gungjungjang are classified as follow: Cheong-jang, Deot(Gyup)-jang,
Jin-jang(Chot-jang), Euyeuk-jang, and Kot-jang. Generally, Cheong-jang,
called as Royal Court Clean Soy Sauce, is a soy sauce that had
b
een
widely enjoyed with the royal court ladies. Deot-jang, Royal Court
Double-Soaked Soy Sauce, is made with the soy sauce of previous year
instead of brine onto the meju. Jin-jang, Royal Court Black Soybean Soy
Sauce, is made with black bean meju. For the production of Euyeuk-jang,
Royal Court Fish and Meat Soy Sauce, a large pottery jar wrapped with
rice straw is buried in the earth and filled in layers with meat (beef,
chicken, etc.) and fish (codfish, sea bream, flatfish, yellow corvine, etc.)
that has been well dried and trimmed together with meju before
b
rine
solution is poured. It should be fermented in the earth for one year.
Kot-jang, Royal Court Flower Soy Sauce, is a soy sauce that has
b
een
fermented and stored for more than 10 years. In this study, functional
properties such as antioxidative and fibrinolytic activities, antibacterial
effect, and α-glucosidase inhibition of Korean traditional soybean-
fermented royal court soy sauces were analyzed in vitro.
Keywords: Gungjungjang, soy sauce, functional property
I-86
Anti-cancer Effect of Cell Wall Component of Lactic Acid Bacteria
Hae Hoon YOON and Hae Choon CHANG*
Dept. of Food and Nutrition, Research Center for Kimchi, Chosun University,
Gwangju, 501-759, Korea.
*Corresponding author: sun_mark@hanmail.net
To investigate the anticancer effect of cell wall component extracted
from lactic acid bacteria (LAB), 6 LAB isolated from kimchi were
examined. The anticancer effect of cell wall extracts were measured on
AGS human gastric adenocarcinoma cells, HT-29 human colon carcinoma
cells and BJ human foreskin normal cells using MTT assay. LAB cell
wall component were extracted and the cell disruption was observed
b
y
Gram-stained cells under light-microscopy. The cell wall extract of all
LAB tested showed growth inhibitory effect on cancer cells (AGS, HT-29).
In particular, Leuconostoc sp. (AGS: 92%, HT-29: 97%), Leuconostoc
sp. (AGS: 96%, HT-29: 94%), and Pediococcus sp. (AGS: 91%, HT-29:
95%) showed higher anticancer effect than the cell wall extracts of the
others, in 1.5 mg/mL of the extracted cell wall component concentration.
However, all cell wall extracts did not show siginificant effect on the
growth of BJ normal cells. This results demonstrated that the cell wall
component isolated from the three LAB had strong anticancer effect.
Keywords: cell wall, anticancer effect, lactic acid bacteria
I-87
Development of Auto-aging System for Chemical Composition
Change and Microflora in Kimchi, a Traditional Fermented Foods
in Korea.
Young-Joo CHAE, Jong-In JEON, Young-Gil LEE, Sung-Kwan PARK and
Ki-Bum PARK*
Research and Development center, WiniaMando Inc., Asan, Chungnam, Republic
of Korea, 336-843.
*Corresponding author: S10774@winiamando.com
Vitamin C (ascorbic acid) is an essential micronutrient required for
normal metabolic functioning of the body. Humans and other primates
have lost the ability to synthesize vitamin C as a result of a mutation
in the gene coding for L-gulonolactone oxidase, an enzyme required for
the biosynthesis of vitamin C via the glucuronic acid pathway. In the
present work we investigated the effects of different storage temperature
of Kimchi on lactic acid bacteria and ascorbic acid levels. There are six
kinds of different fermented Kimchi and the range of temperature are
8~20

. Vitaimin C concentration of Kimchi showed 10.00mg/100g ~
21.09mg/100g. We isolated several microorganisms from Kimchi and it’s
characterization. This information has been facilitating to develop of the
Kimchi fermentation container and their content for a Kimchi refrigerator.
(Supported by grants from WiniaMando Inc. to Young-Joo Chae).
Keywords: Ascorbic acid, Lactic acid bacteria, Kimchi refrigerator
I-88
393
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Studies on the Qualities of rice wine brewed with Different Rice
Varieties
Hyun Ik HWANG, Hui Jeong KIM, Yoon-Ho CHOI and Chang-Min JUNG*
Baesangmyun Brewery co., Ltd.
*Corresponding author: ike4201@soolsool.co.kr
This research was conducted to elucidate the optimum method of
pre-treatment and fermentation conditions to production of high-quality
rice wine. In order to investigate the effect of different rice varieties on
the quality of rice wines, the physicochemical and sensory
characterizations of rice wines from the using 20 different rice varieties
were evaluated. Sample rice wines were analyzed for ethanol, pH, total
acid, organic acids, free sugars and volatile flavor compounds. Volatile
flavor compounds in rice wine were identified by using GC-MSD. Eight
esters, five alcohols compound were identified in rice wines. From varietal
rice lines, about 4 varieties will be recommended to the proper raw material
for the rice wine production. It was shown that mash concentration, water
hardness, different nuruks and different rice cooking degrees affected the
physicochemical and sensory characteristics of the rice wines.[This work
was supported by the Korea Ministry for food, agriculture, forestry and
fisheries]
Keywords: rice wines, volatile flavor compounds
I-89
Comparison of Bacterial Counts and Enzyme Activities of Me
j
u
Prepared with 10 Soybean Cultivars
Song Yi HAN, Dong Jun SIM, Keum Ok KIM and Yong Suk KIM*
Department of Food Science &Technology, Chonbuk National University,
J
eonju,
Jeonbuk 561-756 Korea.
*Corresponding author: kimys08@jbnu.ac.kr
To select the suitable soybean cultivar for meju preparation, the quality
characteristics of meju prepared with 10 soybean cultivars were estimated.
Bacterial counts and enzyme activities were monitored during fermentation
at 30

for 15 days. Aerobic and anaerobic bacterial counts were increased
in all treatment and showed in the range of 9.02 (Karikei434) ~ 10.14
(Jinpum2) log CFU/g after 15 days of fermentation. Mold count was
increased during fermentation and showed in the range of 4.27 (Jinpum2)
~ 6.41 (Taekwang) log CFU/g after 15 days of fermentation. Acidic
protease activities and Neutral protease activities of meju were increased
during fermentation and those of Jinpum2 soybean were the highest
699.433, 323.980 unit/mL after 15 days of fermentation, respectively. α
-Amylase activities of all treatment were increased up to 6 days and then
decreased after 15 days of fermentation and that of Taekwang was the
highest 2.551 unit/ml after 15 days fermentation. β-Amylase activities
were increased during fermentation and showed in the range of 4.112
(Saeol) ~ 4.360 (Danbaek) unit/mL after 15 days of fermentation. From
these results, we estimate that Jinpum2 soybean was the most suitable
soybean cultivar for processing meju.
Keywords: Meju, Bacterial Counts, Enzyme Activities
I-90
Effects of Poly-γ-Glutamic Acid on Calcium Absorption and
its Application for Functional Food Ingredients
Jae-Chul CHOI
1,2
, Seung Ho LEE
3
, Young-Ki RYU
3
and
Moon-Hee SUNG*
1,2
1
BioLeaders Corporation, Daejeon, Korea.
2
Department of
A
dvanced
Fermentation Fusion Science &Technology, Kookmin University, Seoul,
K
orea.
3
R&D center, Pulmuone Holdings Co. Ltd., Seoul, Korea.
*Corresponding author: smoonhee@bioleaders.co.kr
The bioavailability of calcium is currently one of the most important
topics in nutrition research and is correlated with gastrointestinal solubility.
Many studies have confirmed that poly (γ-glutamic acid) (PGA) increases
the solubility of Ca
2+
, suggesting that PGA enhances calcium absorption
in the small intestine. However, there has been no report on the specific
interaction between PGA and Ca
2+
in water. We confirmed the effect
of the γ-PGA on calcium solubility in vitro: the insoluble calcium was
solubilized by γ-PGA in a dose- and molecular-weight-dependent manner.
The chelating ability and binding strength of γ-PGA for Ca
2+
were
evaluated. We also compared the increasing ability of calcium solubility
with CPP (Caseinphosphopeptide) in vitro. Recently, the Korean Food
and Drug Administration (KFDA) approved γ-PGA as a functional food
ingredient that promotes calcium absorption. A useful dosage for calcium
absorption was suggested as 60 - 70 mg per day. Ongoing studies may
suggest more effective applications of calcium for dietary supplements.
[This work was supported by the 'Seoul R&BD Program(10580)’]
Keywords: poly-gamma-glutamic acid, calcium absorption, dietary
supplement
I-91
Adjuvant Role of LPS in Phage SPC35 Adsorption to Salmonella
Typhimurium
Minsik KIM, Sujin KIM and Sangryeol RYU*
Department of Food and Animal Biotechnology, Department of
A
gricultural
Biotechnology and Center for Agricultural Biomaterials, Seoul National
University, Seoul 151-921, Korea.
*Corresponding author: kms84@snu.ac.kr
T5-like phage SPC35, which uses a BtuB protein as host receptor, has
the putative host-interacting apparatus, tail fibers. To examine a possible
association of lipopolysaccharide (LPS) or enterobacterial common antigen
(ECA) in Salmonella Typhimurium with the SPC35-host
b
acteria
interaction, susceptibility of the rfbP (involved in LPS biosynthesis) or
rfe (involved in ECA biosynthesis) deletion mutants to SPC35 was
assessed. In spotting assay, SPC35 formed clearer plaques on the rfbP
mutant compared with the wild type (WT), whereas formed normal plaques
on the rfe mutant, indicating that LPS, rather than ECA, participated in
the phage infection. In contrast to plating results, SPC35 could not infect
Salmonella lacking LPS in shaking culture, but could suppress a growth
of this mutant in static culture. In addition, SPC35 adsorption assay
revealed that the rfbP mutant has a reduced SPC35 adsorption ability,
and that SPC35 specifically adsorbed to LPS of S. Typhimurium. These
results suggested that LPS in S. Typhimurium was not essential for SPC35
infection in the static culture conditions such as on the solid agar plate
or in the culture without shaking, but was required in the shaking culture
conditions to assist the SPC35 adsorption to the host bacteria.
Keywords: Bacteriophage, Salmonella Typhimurium, Lipopolysaccharide
I-92
394
www.kormb.or.k
r

Isolation of Fibrinolytic Enzyme Producing Strain from Doenjang
and Optium Conditions of Enzyme Production
Hye Ju YUN, Hye Sun CHOI, Soo-Hwan YEO and Seong Yeol BAEK*
Fermentation &Food Processing Division, Department of Agro-food Resource,
NAAS, RDA, Suwon 441-853, Korea.
*Corresponding author: dunkbis@korea.kr
This study was investigated to find out optimal medium maximizing
of fibrinolytic enzyme by YJ01-3 strain isolated from Doenjang, which
could hydrolyze the fibrin produced through the blood coagulation
mechanism in human body. Gene sequence analysis of 16S rRNA from
isolated YJ01-3 strains revealed Bacillus species. Among carbon sources
tested, galactose was most effective for the enzyme production. For
nitrogen tested, peptone was most effective for the enzyme production.
And 3% NaCl concentration was most effective for the enzyme production.
The enzyme was maximally produced by cultivating the organism at the
liquid medium of the initial pH9 and temperature of 30

.
Keywords: Doenjang, fibrinolytic, enzyme, microorganism
I-93
Potential Probiotic Strains Isolated from Korean fermented Foods
and Animal Feces
Hwa Jin SIN
1
, Ji Hun BANG
1
, Hye Jung CHOI
2
, Cheol Soo AHN
3
,
Young Kee JEONG
4
, Dong Wan KIM
5
and Woo Hong JOO*
1,2
1
Dept. of Biology,Changwon National University, Changwon 641-773,
K
orea.
2
Dept. of Interdisciplinary Program in Biotechnology,Changwon National
University, Changwon 641-773, Korea.
3
Dept. of Biology,Cho-A Pharm. Co,
LTD., Haman-kun, Korea.
4
Dept. of Biotechnology, Dong-A University,
K
orea.
5
Dept of Microbiology,Changwon National University,Changwon 641-773, Korea.
*Corresponding author: whjoo@changwon.ac.kr
This study assessed potential probiotic strains isolated from Korean
fermented foods such as kimchi, doenjang and animal feces for their
possible use in medicinal field by evaluating their (i) satety; (ii) resistance
to biotic stress such as acid and bile salts; (

)resistance to antibioticis
and (

) adhension capacity to animal cell. Based on 16S ribosomal DNA
sequences analysis, they were assigned to one of three different
b
acterial
groups; Enterococcus, Lactococcus, Lactobacillus and Weissella. Four
strains of Enterococcus, Lactococcus, Lactobacillus and Weissella that
showed resistance to acid and bile salts were selected for further evaluation
of their probiotic properties. Most of the strains were sensitive to
antibiotics such as ampicillin, gentamicin and tetracycline. Especially four
strains elicited antibacterial activity against both Gram-positive
and-negative pathogens. The results suggested that four strains showed
good potential for application in functional foods and health-related
products. (Supported by the Korean Ministry of Education, Science
Technology (MEST) and the National Research Foundation of Korea
(NRFK) through the Human Resource Training Project for Regional
Innovation)
Keywords: probiotics, safety, functional foods
I-94
The Change of Microbial Population in Salted and Fermented
shrimp in Togul, Traditional Food Pantry for Fermentation
Kook-Il HAN
1
, Yong Hyun KIM
1
, Miae JEON
1
, Hyun-Jung KWON
1
,
Keun Chul LEE
2
, Jung Sook LEE
2
and Man-Deuk HAN*
1
1
Department of Biology, College of Natural Science, Soonchunhyang University,
Chungnam 336-745, Korea.
2
Korea Research Institute of Bioscience and
Biotechnology, P.O. Box 115, Yusong, Taejon 305-600, Korea.
*Corresponding author: mdhan@sch.ac.kr
The diversity and change of microbial population in salted &fermented
shrimp(SFS), Acetes japonicus, were monitored by denaturing gradient
gel electrophoresis(DGGE). SFS samples were taken every 7 days over
the fermentation periods (for 84 days) to extract total DNA for DGGE
analysis. DGGE of 16S rRNA gene fragment was used to compare the
microbial communities of these samples. Sequencing results of partial 16S
rDNA amplicons from DGGE profiles revealed 17 bacterial strains. SFS
has the bacterial diversity with the eleven bacteria family Staphyloccaceae,
Curculionoidea, Moraxellaceae, Pseudomonadaceae, Caulobacteraceae,
Halanaerobiaceae, Bacillaceae, Enterococcaceae, Halomonadaceae,
Vibrionaceae and Noctuoidea. We identified that Staphylococcus equorum,
Halanaerobium saccharilyticum, Salimicrobium luteum and
H
alomonas
j
eotgali steadily existed throughout the whole fermentation period.
Psychrobacter jeotgali and Halomonas alimentaria were appeared at 0th
to 21th day. Pseudomonas veronii was appeared at 0th to 28th day. Also
Alkalibacterium putridalgicola, Tetragenococcus muriaticus, and
Salinicoccus jeotgali were appeared from 49th to 84th day, and make
up the majority of the predominant bacteria in SFS.
Keywords: Fermented Shrimp, Microbial Population, DGGE
I-95
Determination of Alcohol Dehydrogenase(ADH) and
Acetaldehyde Dehydrogenase(ALDH) Activities of Lactic Aci
d

Bacteria(LAB) Isolated from Kimchi
Min-Hee PARK, Hyun-Su YEA, Chung-Hoo YOON, Young-Bae NOH,
Go-Woon YOON, You-Young LEE, Gi-Hoon JEUN, Kwang-Sei LIM,
Wan-Sik KIM and Ju-Yong KIM*
R&D Center, Maeil Dairies Co., Ltd, Gyeonggi Province 451-861, Korea.
*Corresponding author: beseen85@maeil.com
In this study, 115 LABs were isolated from various homemade Kimchi,
a Korean traditional fermented vegetable food, alcohol dehydrogenase
(ADH) and acetaldehyde dehydrogenase (ALDH) activities were
measured. After 24hrs incubation in MRS broth, cytosolic fractions o
f

each strain were gained through 30s X 5 in an ice bath sonification and
centrifugation at 13,000 rpm for 60mins (4

). The activities of ADH
and ALDH were measured in vitro conditions with NAD
+
, NADP
+
coenzymes respectively. And substantial amounts of cytosolic protein were
determined to calculate enzyme activity per mg protein. #9, #11, #13,
#17 strains showed relatively high ADH activity and #12, #15 strains
showed high ALDH activity. These strains were identified through API
kit. The identification result showed Lactobacillus brevis,
L
actobacillus
brevis, Lactobacillus collinoides, Weissella confusa,
L
actobacillus
p
lantarum, Weissella confuse, respectively.Further research is needed
b
ut
these strains may have beneficial effect on the host by metabolizing ethanol
and acetaldehyde in case of excessive alcohol intake.
Keywords: ADH, ALDH, Lactic acid bacteria
I-96
395
The Korean Society for Microbiology and Biotechnology
2011 International Symposium &
A
nnual Meeting
Identification and Screening for Bacteriocin-Producing Lactic
Acid Bacteria from Jeju Foxtail Millet-wine, A Traditional
Fermented Korean Beverage.
Yeong Ji OH
1
, Yoo Na LEE
2
and Dong Sun JUNG*
1
1
Department Food Science and Technology, Seoul Women.
2
Department Food
Science and Technology, Seoul Women's University, Seoul, 139-774, Korea.
*Corresponding author: anabaena@swu.ac.kr
This study was carried out to screen bacteriocin-producing lactic acid
bacteria(LAB) from Jeju Foxtail Millet wine, identify the isolates.
Morphological characteristics, Biochemical properties and Growth
conditions were also inveatigate to characterize the bacterial isolates.5
strains of Lactic acid bacteria(LAB) were isolated from Jeju foxtail
millet-wine.Among them, 2 isolates, YJ3 and YJ5, showed the most
prominent antimicrobial activities.the isolates were observed with scanning
electron microscope and exhibited a similar morphology, short rod.YJ5
showed broad tolerance to ethanol(0~12%) and growth in a wide
temperature range.YJ5 maintained to growth up to 9% NaCl conceration
at MRS broth. Antimicrobial activities in cell free supernatant(CFS) o
f

YJ5 were more stable in low temperature(-20

) than that of YJ3. The
maximum antimicrobial activities appeared when 2 isolates were cultured
in MRS broths for 18h. Also, CFS between 24h and 30h showed strong
antimicrobial activities. YJ5 was identified as lactobacillus pentosus and
YJ3 as lactobacillus plantarum with API 50 CHL.
Keywords: jeju Foxtail Millet wine; bacteriocin; lactobacillus pentosus
I-97
Hemicellualse Production by Cellulosimicrobium sp. isolate
Ki-Hong YOON*, Ji Hye YOO and Mi Sung LEE
Department of Food Science &Biotechnology, Woosong University, Korea.
*Corresponding author: ykh@wsu.ac.kr
A bacterium producing the extracellular mannanase and xylanase was
isolated from Korean soil by serial subcultures in a minimal medium
supplemented with palm kernel meal. The isolate WL-1107 has
b
een
identified as Cellulosimicrobium sp. on the basis of its 16S rRNA
sequence. The additional carbohydrates including locust bean gum (LBG)
and palm kernel meal (PKM) increased significantly the mannanase
productivity of strain WL-1107, while the xylanase productivity of the
isolate was increased by wheat bran or oat spelt xylan. PKM induced
mannanase production more than LBG, and wheat bran induced xylanase
production more than xylan. When the isolate cultured in LB
b
roth
supplemented with the mixture of palm kernel meal and wheat bran,
b
oth
of xylanase and mannanase was produced so poorly by the isolate. The
mannanase of culture supernatant in tryptic soy broth supplemented with
PKM (0.7%) was the most active at 55

and pH 6.5, and the xylanase
of culture supernatant in LB supplemented with wheat bran (1 %) the
most active at 65

and pH 5.5.
Keywords: Cellulosimicrobium sp., xylanase, mannanase
I-98
Optimal Production of Exopolysaccharide by Bacillus
licheniformis KS-17 Isolated from Korean Traditional Fermented
Food, Kimchi
Young-Ran SONG and Sang-Ho BAIK*
Department of Food Science and Human Nutrition, and Research Institute o
f

Human Ecology, Chonbuk National University, Jeonju, Jeonbuk 561-756, Korea.
*Corresponding author: baiksh@jbnu.ac.kr
In our previous study, we isolated Bacillus licheniformis KS-17 strain
producing exopolysaccharide (EPS) consisting glucose from Kimchi and
founded that the EPS showed high level antioxidant activities and
inhibitory effect on tyrosinase. In this work, we tried to find optimal culture
condition for EPS production by B. licheniformis KS-17 through carbon
sources, nitrogen, phosphate and bioelement sources and concentration
of the selected sources. We also investigated the effect of initial pH and
temperature for fermentation and kinetics for optimal EPS production
b
y
B. licheniformis sp. As results, maximum EPS production by the strain
was obtained in the medium with sucrose 100 g/L, ammonium sulfate
30 g/L, 10 mM calcium chloride at 37
o
C, 5 days at an initial pH adjusted
to 8.5. Under optimal culture conditions, each EPS was able to produce
up from 11.1 ± 0.66 g/L (at 7 days) to approximately 27.2 ± 1.05 g/L
(at 5 days) which showed 2.5 times higher production yield than no
optimization of conditions. Our results in this study clearly showed that
the productivity of the strain is good enough to make EPS production
profitable for the food industry where generally has been known that the
EPS productivity should be enhanced to at least 10-15 g/L for industrial
application.
Keywords: Exopolysaccharide, Optimization, Bacillus licheniformis
I-99
Over Expression of Candida fermentati SI Exo-β-(1,3)-Glucanase
in Pichia pastoris X-33
Bong-Ki KIM, Sang-Hee LEE, Jai-Hyun SO and In-Koo RHEE*
Department of Agricultural Chemistry, Kyungpook National University, 1370
Sankyunk-dong, Buk-gu, Daegu 702-701, Korea.
*Corresponding author: huga1124@naver.com
The soy isoflavones, genistein and daidzein have great interest in the
treatment of cancer, osteoporosis, heart disease and development of
geriatric diseases. Most of isoflavones in soybeans and unfermented soy
foods exist in the β-glucosides and it has been known that the physiological
activities of isoflavone glucosides are less than isoflavone aglycones. In
the previous study, Candida fermentati SI which can produce exo-β
-(1,3)-glucanase that efficiently convert isoflavone glycoside to aglycone
was isolated and the enzyme was purified by several purification steps.
Pichia pastoris which is highly successful heterologous expression system
is used for over-expression. Recombinant exo-β-(1,3)-glucanase was
purified by Ni+-NTA His bind resin chromatography. Optimal pH of the
recombinant exo-β-(1,3)-glucanase is 4.5 and optimal temperature is 40

.
The enzyme shows into activity toward laminarin (apparent Km, 5.30

/

; Vmax, 6.09 U/

protein) and p-Nitrophenyl-β-D-glucopyranoside
(apparent Km, 3.05 mM; Vmax, 6.09 U/mg protein) and p-nitrophenyl-β
-D-xylopyranoside (apparent Km, 24.49 mM; Vmax, 5.42 U/

protein).
The enzyme also shows activity toward isoflavone daidzin (apparent Km,
83.20 μM; Vmax, 838.08 U/

protein) and genistin (apparent Km, 137.86
μM; Vmax, 835.92 U/

protein).
Keywords: Isoflavone, Candida fermentati, Glucosidase
I-100
396
www.kormb.or.k
r

Isolation and Characterization of Lactobacillus Pentosus Kimchi
from the Fermented Korean Food, Cutlassfish Kimchi
Ji-Hyeong KIM
1
, Mi-Sun KWAK
1
, Hyeon-Jun SON
1
, Se-Jeung JANG
2
,
Jong-Bok RHO
3
, Young-Ki CHOI
4
and Moon-Hee SUNG*
1
1
Dept. of Advanced Fermentation Fusion Science &Technology,
K
ookmin
University, Korea.
2
Dept. Bio &Nanochemistry, Kookmin University, Seoul,
Korea.
3
BioLeaders Corporation, Daejeon, Republic of Korea.
4
College o
f

Medicine &Medical Research Institute, Chungbuk National University, Korea.
*Corresponding author: safe2112@hanmail.net
Kimchi, a Korean traditional fermented food, is prepared with various
vegetables such as cabbage, radishes, spices, and other seasonings. The
fermentation of kimchi is carried out by microorganisms, mainly GRAS
lactic acid bacteria (GRAS-LAB). Recently, several health functions o
f

kimchi have been reported, including antimicrobial effects and anti-viral
effects. In order to isolate kimchi LAB, which has antimicrobial and
anti-viral effects, we screened the kimchi LAB from cutlassfish kimchi.
We isolated kimchi LAB that could grow in an MRS plate medium
containing 2% CaCO
3
. Finally, one strain was selected for the protease
activity on a 1% milk plate medium. The isolated strain was identified
according to its phenotypic characteristics and the data from the
phylogenetic sequence analysis of the 16
S
rRNA gene. We examined
antimicrobial activity, antifungal activity, and anti-viral activity with
cell-free supernatants and a culture broth of kimchi LAB grown in MRS
broth. [This work was supported by the Seoul R&BD Program (10580)
and Top Brand Project grant from Korea Research Council of Fundamental
Science &Technology (KGM3110912).]
Keywords: fermentation, Kimchi, lactobacillus
I-101
J
_ Environmetal Microbiology and Engineering
Growth Promoting Effect of Alginate on Nannochloropsis oculata
Hyun-Jin PARK
1
, Young-Hwa KIM
2
and Jae-Hwa LEE*
1
1
Department of Bioscience and Biotechnology, College of Medical and Life
Science, Silla University, Busan 617-736, Korea.
2
Department of
P
harmaceutical
Engineering, College of Medical and Life Science, Silla University, Busan
617-736, Korea.
*Corresponding author: phj0386@naver.com
The growth of Nannochloropsis oculata (N. oculata), unicellular
microalgae, by alginate was investigated. Alginate was depolymerized with
sulfuric acid (H
2
SO
4
) and heat (121

), simultaneously. Addition of 0.75%
alginate oligomer depolymerized with 0.2 N H
2
SO
4
showed the maximum
yield and the growth rate of N. oculata. Chlorophyll content and reducing
sugar was increased by alginate oligomer in a dose-dependent manner.
Alginate oligomer promoted the growth of N. oculata, whereas the original
alginate polysaccharides had no significant effect. Laminaria japonica (
L
.
j
aponica) extract containing high level of alginate was also increased
growth rate and chlorophyll content. CO
2
supply addition to L. japonica
extract showed no change the growth rate, although addition to alginate
oligomer showed prominently increased. N. oculata could use more
saccharides in presence of CO
2
according to reducing sugar determination.
From these results, it is useful to establish optimal condition for high
cell density cultivation of N. oculata.
Keywords: Alginate, Nannochloropsis oculata, Laminaria japonica
J-1
Molecular Monitoring of Microbes in Surface water and
Distribution System of Pipeline using PCR-DGGE
Hee Suk LEE*
1
, Sun-Bok GEUN
2
and Min Jeoung KIM
1
1
K-water.
2
KOTTI.
*Corresponding author: lovealga@kwater.or.kr
The objective of this study is to monitor the microorganisms in various
surface water and distribution system of pipeline in the use of Denaturation
Gradient Gel Electrophoresis (DGGE) system. Five major surface water
(GR, DH, BS, IS, CJ) and two samples of distribution system (DB, US)
in the pipeline were used. Nucleic acids of these samples were amplified
using PCR and confirmed by DGGE using 8% polyacryamide gel. The
microbial communities of samples which were taken in November were
more diversified than in August. The microbial community in the
distribution system was also observed and compared with the data from
surface water. The diversity of microbial community in the distribution
system is less than that of surface wate. The PCR-DGGE methods can
be used as a useful tool to compare the microbial community and expect
the variation of microbial community.
Keywords: Monitoring, PCR-DGGE, Surface water
J-2
Growth Kinetics of Algae under the Influence of Antibiotics
using Toxy-PAM
Man-Gi CHO*, Pina KNAUFF, Katharina KRÄHLING, Thomas AMBROSI,
Vera KEIL, Khalida MANSOURI, Daniel ASCHENBRENNER,
Binod PRASAD and Thiyam GENERAL
Department of Bio-Chemical Engineering, Dongseo University Graduate
School,Busan 617-716, Republic of Korea.
*Corresponding author: mgcho@gdsu.dongseo.ac.kr
With increasing importance of micro algae in the pharmacy, medicine,
environmental engineering and further fields, it is necessary to investigate
growth conditions and potential growth inhibitors. Genetical modifications
of micro algae strains can be an alternative to meet the increasing demand
of valuable compounds from micro algae. Thus the following work with
respect to suspectibility of micro algae Tetraselmis suecica, Marine
Chlorella sp. and Haematococcus pluvialis against antibiotic was carried
out to investigated the growth kinetics under influence of antibiotics.
Different concentration were applied and the strains were incubated for
7 days. The cell number, the optical density (OD) and the fluorescence
activity (F0, Fm, Y) using Toxy PAM were measured.The cell number
and the optical density are continuously increasing with the time. The
fluorescence activity appears independent of the antibiotic concentration.
Keywords: Microalgae, Antibiotics and Fluorescence, Growth Kinetic
J-3